G138686


Basic Information

Item Value
gene id G138686
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 2052580 ~ 2052935 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU157572
TCACGTGCTGCTGCAAGCGGAATTCCACACTTTCCTCATCCTAACGTTACATTCATGCACGCTCACTTCTGCTTTTTAATAGTGACAAGGATAATATCCAATACGAGGCGATGAGGCTTATGTTAATCAATTTAATCCCAAATGCGTGCCGTGTGAGCACGTGTATTTTTTTCGAAATGAAACTAACTGCATGACATTTTTTAGTCAACTTAGTCAAAGTATGTGATTTATTTCTGTTCACGATTGTTAGCAGAATGTTCCCCAGTATGTATGGGGGGGAGATTTATAGAAAAGGAAATGATAAACCAAACATAGATGCACATGCTTTGAAAGATGTGAATCAACAAGTTATTACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU157572 True 356 lncRNA 0.38 1 2052580 2052935

Neighbor

gene id symbol gene type direction distance location
CI01000027_02040721_02047487 NA coding upstream 5014 2040621 ~ 2047566 (+)
CI01000027_02034579_02038173 NA coding upstream 13526 2034360 ~ 2039054 (+)
CI01000027_01998746_02018404 NA coding upstream 33791 1998672 ~ 2018789 (+)
CI01000027_01982332_01985064 NA coding upstream 67423 1982034 ~ 1985157 (+)
CI01000027_01976509_01978931 NA coding upstream 71859 1976448 ~ 1980721 (+)
CI01000027_02059709_02072254 GAPDHS, G3PT, GAPDH coding downstream 6442 2059377 ~ 2072405 (+)
CI01000027_02083444_02085743 NA coding downstream 30208 2083143 ~ 2085780 (+)
CI01000027_02106256_02118045 NA coding downstream 53250 2106185 ~ 2118498 (+)
CI01000027_02125080_02146147 NA coding downstream 71899 2124834 ~ 2146502 (+)
CI01000027_02156853_02161914 RBM42 coding downstream 103918 2156853 ~ 2162004 (+)
G138627 NA non-coding upstream 86974 1965332 ~ 1965606 (+)
G138625 NA non-coding upstream 90724 1961552 ~ 1961856 (+)
CI01000027_01937897_01954661 NA non-coding upstream 102971 1937754 ~ 1954787 (+)
G138612 NA non-coding upstream 141029 1911283 ~ 1911551 (+)
G138610 NA non-coding upstream 143112 1909242 ~ 1909468 (+)
G138672 NA non-coding downstream 24145 2077080 ~ 2082052 (+)
G138693 NA non-coding downstream 66263 2119198 ~ 2119793 (+)
G138649 NA non-coding downstream 96394 2149329 ~ 2153741 (+)
G138656 NA non-coding downstream 101634 2154569 ~ 2155082 (+)
CI01000027_02254195_02308930 NA non-coding downstream 200613 2253903 ~ 2310086 (+)
G138515 NA other upstream 375720 1664408 ~ 1676860 (+)
G138436 NA other upstream 544764 1506961 ~ 1507816 (+)
G138290 NA other upstream 1053399 995970 ~ 999181 (+)
G138247 NA other upstream 1183005 855388 ~ 893121 (+)
G138238 NA other upstream 1220897 829774 ~ 831683 (+)
G138915 NA other downstream 1431452 3484387 ~ 3486647 (+)
G138953 NA other downstream 1449137 3502072 ~ 3520065 (+)
G140436 NA other downstream 2684463 4737398 ~ 4774262 (+)
G140440 NA other downstream 2727482 4780417 ~ 4785660 (+)
CI01000027_05050310_05055447 NA other downstream 2995988 5050310 ~ 5055755 (+)

Expression


Co-expression Network