CI01000028_09754780_09768698 (GINS2, GINS2.L, PSF2)


Basic Information

Item Value
gene id CI01000028_09754780_09768698
gene name GINS2, GINS2.L, PSF2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 9754780 ~ 9768698 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000028_09754780_09768698.mRNA
ATGGATCCAGCGGAGGTAGAGTTTCTCGCAGAGAAAGAGATGGTAAAAATAATCCCGAACTTCAGTCTCGACAAAATCTATTTGATTGGGGGAGATCTGGGCCCATTTAATCCGGGTCTGCCTGTGGAAGTTCCTGTGTGGTTGGCCCTCAATCTTAAACAAAGGCAGAAATGCAGGATAGTTCCTCCAGAATGGATGGACACTGACAAACTAGAGGAGATCCGTGAACAGGAGAGAAAGCTAGACACTTTCACTCCCATACCGAGTCCATATTACATGGAGCTGACTAAATTATTACTCAACCATGCTGCAGATAACATTCCCAAAGCCGATGAGATCCGAACCCTGGTCAAGGATATCTGGGATACACGCGTGGCCAAACTGAGACTTTCTGCTGACAGCTTCATCAGCCAGCAGGAGGCTCACGCGCAGCTGGATAACCTCACGCTAATGGAGATCAACACCACACGCTCATTTCTGCTCGATTCTCTGAACTACATGTATAAACTGCGCTCAAACCTGCAGCCGGGCAGAAGTCAGGACTAC

Function

symbol description
gins2 Predicted to be involved in double-strand break repair via break-induced replication. Predicted to act upstream of or within DNA replication. Predicted to be located in nucleus. Predicted to be part of GINS complex. Orthologous to human GINS2 (GINS complex subunit 2).
psf2 Involved in chromosome condensation. Part of CMG complex and GINS complex. Is expressed in organism. Orthologous to human GINS2 (GINS complex subunit 2).

GO:

id name namespace
GO:0000727 double-strand break repair via break-induced replication biological_process

KEGG:

id description
K10733 GINS2, PSF2; GINS complex subunit 2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000028_09754780_09768698.mRNA True 546 mRNA 0.48 5 9754780 9768698

Neighbor

gene id symbol gene type direction distance location
CI01000028_09731014_09732318 NA coding downstream 22225 9730908 ~ 9732555 (-)
CI01000028_09686064_09687018 NA coding downstream 67760 9685898 ~ 9687020 (-)
CI01000028_09620918_09652565 NA coding downstream 102120 9619826 ~ 9652660 (-)
CI01000028_09469357_09494746 NA coding downstream 260034 9469343 ~ 9494746 (-)
CI01000028_09463027_09468717 NA coding downstream 286063 9462374 ~ 9468717 (-)
CI01000028_09771470_09791854 EMC8 coding upstream 2272 9770970 ~ 9791962 (-)
G151114 NA non-coding downstream 242810 9511419 ~ 9511970 (-)
G151104 NA non-coding downstream 316754 9437321 ~ 9438026 (-)
G151070 NA non-coding downstream 335198 9412238 ~ 9419582 (-)
G151095 NA non-coding downstream 383165 9370650 ~ 9371615 (-)
G151094 NA non-coding downstream 385276 9369105 ~ 9369504 (-)
G151288 NA non-coding upstream 34574 9803272 ~ 9803734 (-)
G151291 NA non-coding upstream 38127 9806825 ~ 9807053 (-)
G151292 NA non-coding upstream 38452 9807150 ~ 9807460 (-)
G151295 NA non-coding upstream 42421 9811119 ~ 9819353 (-)
G151297 NA non-coding upstream 52553 9821251 ~ 9825209 (-)
G150328 NA other downstream 1061037 8693398 ~ 8693743 (-)
G149923 NA other downstream 1730536 7974568 ~ 8024244 (-)
CI01000028_07527725_07535631 ARPP19 other downstream 2219037 7525962 ~ 7535743 (-)
G149474 NA other downstream 2521997 7229791 ~ 7232783 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_013491 gins2 coding NC_007129.7 CM002902.2 30481030 ~ 30499489 (-)