G147610


Basic Information

Item Value
gene id G147610
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000028
NCBI id null
chromosome length 9874160
location 5137597 ~ 5137899 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU167655
CATCATTTTGAAGCAAAAACTCTAGTCTACAACCTCCAATACCCAGAAGTCTTGTGAACACAGATTTAATATATTTTTTTTGGCTTTATTTCAGTGACTTAAGTTTTTTGTTTTTTCAATAACCATGCATAAATGTTATTCCTTCAAAAACACAAACATGTACATACATGTTCCTCACATATTATTGTAGCCTAGTTTGTGCTGAATACAGTGTAATGACACTTTTTCCATTAATATGTTTATGAACAACTGAAAAAAGCACAAATGTCAGGGCATGTCAAAACTTCTCCAGGGCCCTGAAAA

Function

NR:

description
PREDICTED: acetylcholine receptor subunit beta

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU167655 True 303 lncRNA 0.32 1 5137597 5137899

Neighbor

gene id symbol gene type direction distance location
CI01000028_05120588_05127452 GRK7B coding upstream 8568 5120183 ~ 5129029 (+)
CI01000028_05114584_05116494 RNF7, RBX2 coding upstream 20535 5113518 ~ 5117062 (+)
CI01000028_05039088_05063207 NA coding upstream 74390 5039088 ~ 5063207 (+)
CI01000028_04729544_04888382 CNTN5 coding upstream 249215 4729544 ~ 4888382 (+)
CI01000028_04441930_04444388 TTC36 coding upstream 693117 4441866 ~ 4444480 (+)
CI01000028_05178115_05181202 FZD9B, FZD9 coding downstream 38526 5176425 ~ 5181220 (+)
CI01000028_05488773_05490277 NA coding downstream 349133 5487032 ~ 5490635 (+)
CI01000028_05507920_05512856 ZBTB38 coding downstream 368979 5506878 ~ 5512879 (+)
CI01000028_05513089_05514983 NA coding downstream 375077 5512976 ~ 5515363 (+)
CI01000028_05529016_05564762 RASA2 coding downstream 391117 5529016 ~ 5565685 (+)
G147608 NA non-coding upstream 5092 5132294 ~ 5132505 (+)
G147604 NA non-coding upstream 13180 5124089 ~ 5124417 (+)
G147595 NA non-coding upstream 29654 5107618 ~ 5107943 (+)
G147583 NA non-coding upstream 50603 5086720 ~ 5086994 (+)
G147482 NA non-coding upstream 542832 4587296 ~ 4594765 (+)
G147612 NA non-coding downstream 9599 5147498 ~ 5147963 (+)
G147635 NA non-coding downstream 77326 5215225 ~ 5216022 (+)
G147637 NA non-coding downstream 80394 5218293 ~ 5218541 (+)
G147638 NA non-coding downstream 81133 5219032 ~ 5219351 (+)
G147461 NA non-coding downstream 107532 5245431 ~ 5258064 (+)
G147462 NA other upstream 147759 4958703 ~ 4989838 (+)
G145843 NA other upstream 2113377 3023146 ~ 3024220 (+)
CI01000028_00525538_00533862 NA other upstream 4615666 524647 ~ 535245 (+)
G147636 NA other downstream 78191 5216090 ~ 5216611 (+)
G147693 NA other downstream 302555 5440454 ~ 5453610 (+)
CI01000028_07470324_07471346 NA other downstream 2331993 7469543 ~ 7471432 (+)
CI01000028_08302370_08504940 SPON1, SPON1A other downstream 3164348 8302247 ~ 8504940 (+)
G150398 NA other downstream 3653836 8791735 ~ 8792120 (+)

Expression


Co-expression Network