CI01000029_08178470_08183999 (PSMG4)


Basic Information

Item Value
gene id CI01000029_08178470_08183999
gene name PSMG4
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 8178420 ~ 8183999 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000029_08178470_08183999.mRNA
ATGGAGACTGTGGCGAACGGTGACTGCAGCGCTCAGGCGCCTGTGGAGTCCATCACTGTTCATGATTTCTCGGAGAAGATCCTGGAGCAGCAGGTTAATTTCCATGTGATGAAGCTGAGCGGCGGATTCTTCCTCTGGATCGGTTCCAACCCGGTTCTGTCGAATCTGGCCGTTTCCATCGTCAGTAAATATGATTCAATGCCTCTGTCTACTCTGGTGCTGGGCGACACGTCAGACACGACACCAAGCTCTCTCGCGCAGAGACTGACAAAGAAGACAAAGAAACAGGTATTTGTAAGTTACAATTTACCCATGACGGACTCAAATCTTGCATTACTGGTGGAGGACAGAATCAAAAAGGAGATGGAGCTTCATCCTGACAAGTTTTAAACATTCACTGTTTTACTTCATGGCACTTCTTTTGTACATAGCTCAATAAA

Function

symbol description
psmg4 Orthologous to human PSMG4 (proteasome assembly chaperone 4).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000029_08178470_08183999.mRNA True 440 mRNA 0.47 3 8178420 8183999

Neighbor

gene id symbol gene type direction distance location
CI01000029_08100383_08125091 NA coding downstream 53329 8099888 ~ 8125091 (-)
CI01000029_08092122_08094899 NA coding downstream 83521 8091667 ~ 8094899 (-)
CI01000029_08083189_08089291 TBC1D7 coding downstream 89129 8082757 ~ 8089291 (-)
CI01000029_08041274_08048935 NA coding downstream 128993 8040747 ~ 8049427 (-)
CI01000029_07946659_07953611 TSTA3 coding downstream 224809 7946402 ~ 7953611 (-)
CI01000029_08185095_08190376 NA coding upstream 1030 8185029 ~ 8190376 (-)
CI01000029_08205518_08214627 NA coding upstream 21471 8205470 ~ 8214627 (-)
CI01000029_08229070_08234969 CTSBB coding upstream 44966 8228965 ~ 8234969 (-)
CI01000029_08237701_08245368 FDFT1 coding upstream 52918 8236195 ~ 8245368 (-)
CI01000029_08250264_08262665 GATA4 coding upstream 66250 8250249 ~ 8262665 (-)
G156736 NA non-coding downstream 248077 7929759 ~ 7930343 (-)
G156661 NA non-coding downstream 449215 7728966 ~ 7729205 (-)
G156659 NA non-coding downstream 459383 7718713 ~ 7719037 (-)
G156633 NA non-coding downstream 524679 7643283 ~ 7653741 (-)
G156718 NA non-coding upstream 36391 8220390 ~ 8226568 (-)
G156850 NA non-coding upstream 83401 8267400 ~ 8267662 (-)
G156851 NA non-coding upstream 86753 8270752 ~ 8271021 (-)
G156852 NA non-coding upstream 87450 8271449 ~ 8271686 (-)
G156495 NA other downstream 808873 7365007 ~ 7371921 (-)
G156542 NA other downstream 1007469 7170367 ~ 7170951 (-)
G154415 NA other downstream 3190995 4986108 ~ 4990990 (-)
CI01000029_04460778_04463540 FKBP1B other downstream 3701208 4460159 ~ 4463540 (-)
CI01000029_03698769_03707177 NA other downstream 4471168 3698572 ~ 3707883 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_018500 CABZ01115113.1 coding NC_007131.7 CM002904.2 53169969 ~ 53176675 (-)