G151702


Basic Information

Item Value
gene id G151702
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 524909 ~ 525212 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU172318
GCATGCAGACTGCTTCTACAAACATTTGTGAAAGAATGGGTCGCTCTCAGGAGCTCAGTGGATTCAAGCGTGGTACCGTGATAGGTTGCCACCTGTGCAATAAGTCCATTCGTGAAATTTCCTCACTACTAAATATTCCACGGTCAACTGTTAGTGGTATCATAACAAAGTGGAAGCAATTGGGAACAACAGCAACTCAGCCACGAAGTGGTAGGCCACATAAAATCACAGAGCGGGGTCAGCGCATGCTGAGGCGCACAGTGCGCAGAAGTCGCCAACTTTCTGCAGAGTCAATAGCTACAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU172318 True 304 lncRNA 0.48 1 524909 525212

Neighbor

gene id symbol gene type direction distance location
CI01000029_00469836_00474738 NA coding upstream 49963 469836 ~ 474946 (+)
CI01000029_00443200_00452374 SPATS1, CNIH3 coding upstream 71837 441131 ~ 453072 (+)
CI01000029_00321187_00331540 NA coding upstream 193034 320130 ~ 331875 (+)
CI01000029_00263434_00300185 CD2AP coding upstream 224533 263434 ~ 300376 (+)
CI01000029_00643229_00643768 SRP09, SRP9 coding downstream 117351 642563 ~ 644285 (+)
CI01000029_00645958_00649352 EPHX1 coding downstream 120746 645958 ~ 649924 (+)
CI01000029_00711035_00714680 NA coding downstream 185740 710952 ~ 714948 (+)
CI01000029_00718512_00738422 NCOA1, FAM184A coding downstream 192283 717495 ~ 738592 (+)
CI01000029_00751587_00751771 ABRACL, CF115 coding downstream 226375 751587 ~ 752779 (+)
G151681 NA non-coding upstream 63031 459158 ~ 461878 (+)
G151418 NA non-coding upstream 176003 341479 ~ 348906 (+)
G151493 NA non-coding upstream 184665 339988 ~ 340244 (+)
G151471 NA non-coding upstream 275825 248744 ~ 249084 (+)
G151409 NA non-coding upstream 336977 183240 ~ 187932 (+)
G151705 NA non-coding downstream 2440 527652 ~ 528002 (+)
G151677 NA non-coding downstream 9855 535067 ~ 535586 (+)
G151672 NA non-coding downstream 25609 550821 ~ 559637 (+)
G151758 NA non-coding downstream 144273 669485 ~ 669763 (+)
G151495 NA other upstream 152987 366541 ~ 371922 (+)
G151415 NA other upstream 299664 170521 ~ 225245 (+)
CI01000029_01526863_01527414 NA other downstream 1001574 1526754 ~ 1527899 (+)
G152451 NA other downstream 2236382 2761594 ~ 2762939 (+)
G153475 NA other downstream 3019913 3545125 ~ 3562004 (+)
G153790 NA other downstream 4208377 4733589 ~ 4740107 (+)
G154587 NA other downstream 4745808 5271020 ~ 5271535 (+)

Expression


Co-expression Network