G154335


Basic Information

Item Value
gene id G154335
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 5024881 ~ 5025182 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU175232
GTTTAAAGATAAACATCCATCCTTTTGTACGGAGGTACCGGGAAACGTTAATCGCGCGCTGACGTGCCCATGTTTACATGCACGCGGATCTGAAAGCCCGGTAATGCGACACCGTTAACTGTACACCATTTTGATTTACAGGTTAAAATAGCGTTGAGAAGATGACTTTGTTACAGGAAATAAAAATGAGAGAGGACTTGAACAGCTTGGCTCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU175232 True 215 lncRNA 0.44 2 5024881 5025182

Neighbor

gene id symbol gene type direction distance location
CI01000029_04981453_04995255 NA coding upstream 29219 4981145 ~ 4995662 (+)
CI01000029_04590418_04605290 NA coding upstream 419187 4590284 ~ 4605694 (+)
CI01000029_04521600_04521771 NA coding upstream 502130 4521600 ~ 4522751 (+)
CI01000029_04478628_04483582 NA coding upstream 541280 4476420 ~ 4483601 (+)
CI01000029_04409794_04419021 OPN8B coding upstream 605860 4409794 ~ 4419021 (+)
CI01000029_05041887_05044363 NA coding downstream 15815 5040997 ~ 5045063 (+)
CI01000029_05104260_05107686 BMP2B coding downstream 78037 5103219 ~ 5107804 (+)
CI01000029_05232703_05233677 TAAR11 coding downstream 205010 5230192 ~ 5234070 (+)
CI01000029_05267765_05268790 TAAR64, TAAR13E, TAAR13D, TAAR13C, TAAR13B coding downstream 242508 5267690 ~ 5268884 (+)
CI01000029_05274996_05279739 TAAR64, TAAR13E, TAAR13D, TAAR13C, TAAR13B coding downstream 249642 5274824 ~ 5279770 (+)
G154342 NA non-coding upstream 1591 5019748 ~ 5023290 (+)
G154334 NA non-coding upstream 6229 5017435 ~ 5018652 (+)
G154378 NA non-coding upstream 18920 5005670 ~ 5005961 (+)
G154341 NA non-coding upstream 37483 4986762 ~ 4987398 (+)
G154372 NA non-coding upstream 47358 4977231 ~ 4977523 (+)
G154340 NA non-coding downstream 23804 5048986 ~ 5049387 (+)
G154398 NA non-coding downstream 35872 5061054 ~ 5061415 (+)
G154586 NA non-coding downstream 244950 5270132 ~ 5270380 (+)
G154560 NA non-coding downstream 332973 5358155 ~ 5358603 (+)
G154511 NA non-coding downstream 394930 5420112 ~ 5424220 (+)
G153790 NA other upstream 284774 4733589 ~ 4740107 (+)
G153475 NA other upstream 1462877 3545125 ~ 3562004 (+)
G152451 NA other upstream 2261942 2761594 ~ 2762939 (+)
CI01000029_01526863_01527414 NA other upstream 3496982 1526754 ~ 1527899 (+)
G151495 NA other upstream 4652959 366541 ~ 371922 (+)
G154587 NA other downstream 245838 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 432059 5461497 ~ 5470346 (+)
G155079 NA other downstream 1257503 6282685 ~ 6288398 (+)
G155083 NA other downstream 1406353 6431535 ~ 6490294 (+)
CI01000029_06906861_06907157 NA other downstream 1881006 6905834 ~ 6908633 (+)

Expression


Co-expression Network