G154341


Basic Information

Item Value
gene id G154341
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 4986762 ~ 4987398 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU175238
ACCGCTGGGCTTCGCTCACTCGCTCCACCAGCATCATCACTTCCTCTTCCTGTGTGGGGAAGGCGGGCAGTTTCTTCCCGATCAGCGTTTCGATTCGCTGAAACAGCTCCACATCATACTGTGTGACGAAGGTGATGGATTTCCCAGATCTCCCTGCTCTCGCCGTGCGGCCCACGCGGTGGATGTAGTCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU175238 True 192 lncRNA 0.58 2 4986762 4987398

Neighbor

gene id symbol gene type direction distance location
CI01000029_04590418_04605290 NA coding upstream 381068 4590284 ~ 4605694 (+)
CI01000029_04521600_04521771 NA coding upstream 464011 4521600 ~ 4522751 (+)
CI01000029_04478628_04483582 NA coding upstream 503161 4476420 ~ 4483601 (+)
CI01000029_04409794_04419021 OPN8B coding upstream 567741 4409794 ~ 4419021 (+)
CI01000029_04389599_04399047 OPN8A coding upstream 587697 4389599 ~ 4399065 (+)
CI01000029_05041887_05044363 NA coding downstream 53599 5040997 ~ 5045063 (+)
CI01000029_05104260_05107686 BMP2B coding downstream 115821 5103219 ~ 5107804 (+)
CI01000029_05232703_05233677 TAAR11 coding downstream 242794 5230192 ~ 5234070 (+)
CI01000029_05267765_05268790 TAAR64, TAAR13E, TAAR13D, TAAR13C, TAAR13B coding downstream 280292 5267690 ~ 5268884 (+)
CI01000029_05274996_05279739 TAAR64, TAAR13E, TAAR13D, TAAR13C, TAAR13B coding downstream 287426 5274824 ~ 5279770 (+)
G154372 NA non-coding upstream 9239 4977231 ~ 4977523 (+)
G154371 NA non-coding upstream 9776 4976728 ~ 4976986 (+)
G154368 NA non-coding upstream 13236 4973178 ~ 4973526 (+)
G154366 NA non-coding upstream 23194 4963348 ~ 4963568 (+)
G154361 NA non-coding upstream 27054 4959495 ~ 4959708 (+)
G154378 NA non-coding downstream 18272 5005670 ~ 5005961 (+)
G154334 NA non-coding downstream 30037 5017435 ~ 5018652 (+)
G154342 NA non-coding downstream 32350 5019748 ~ 5023290 (+)
G154335 NA non-coding downstream 37483 5024881 ~ 5025182 (+)
G154340 NA non-coding downstream 61588 5048986 ~ 5049387 (+)
G153790 NA other upstream 246655 4733589 ~ 4740107 (+)
G153475 NA other upstream 1424758 3545125 ~ 3562004 (+)
G152451 NA other upstream 2223823 2761594 ~ 2762939 (+)
CI01000029_01526863_01527414 NA other upstream 3458863 1526754 ~ 1527899 (+)
G151495 NA other upstream 4614840 366541 ~ 371922 (+)
G154587 NA other downstream 283622 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 469843 5461497 ~ 5470346 (+)
G155079 NA other downstream 1295287 6282685 ~ 6288398 (+)
G155083 NA other downstream 1444137 6431535 ~ 6490294 (+)
CI01000029_06906861_06907157 NA other downstream 1918790 6905834 ~ 6908633 (+)

Expression


Co-expression Network