G155061


Basic Information

Item Value
gene id G155061
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 6246338 ~ 6246643 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU176069
GTTTCTCTTCATATCGTATAAATCTTTCGCCTTTTACTAAAGATTTCCGTGGAGAGGAACGCTATGAGTACAAACTAATTTTTTGATGTCCTGCTTAACGGCGGGACTCTCAATTCTGTTAAAATGATAGCGATTGTGATTTTTTTTTCTATCGTTGTTAATAATTAGTGATATTTTCTAATTGTGTTGTACCGTAAACGGAATGTTCAAATACAGCATTTCGGTTAATTACGTGCACTTTTTCCTTTAGGGATTTTGAATGTCACACCTCGCAGTGTTTACACTACAAAATGGCATATAATCAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU176069 True 306 lncRNA 0.34 1 6246338 6246643

Neighbor

gene id symbol gene type direction distance location
CI01000029_06214396_06222690 NA coding upstream 23603 6212878 ~ 6222735 (+)
CI01000029_06086495_06092753 NA coding upstream 152479 6086495 ~ 6093859 (+)
CI01000029_06076254_06083211 XKR5 coding upstream 162127 6076121 ~ 6084211 (+)
CI01000029_06066859_06073942 NA coding upstream 172364 6066859 ~ 6073974 (+)
CI01000029_06015438_06024591 HADHA, HADHAA coding upstream 221255 6015438 ~ 6025083 (+)
CI01000029_06294088_06295613 NA coding downstream 46376 6293019 ~ 6296026 (+)
CI01000029_06305668_06307332 NKX2.4B coding downstream 58602 6305245 ~ 6307675 (+)
CI01000029_06347167_06348123 NA coding downstream 100017 6346660 ~ 6348169 (+)
CI01000029_06443365_06447942 CRNKL1 coding downstream 196722 6443365 ~ 6447942 (+)
CI01000029_06453008_06476863 NA coding downstream 206365 6453008 ~ 6477090 (+)
G155060 NA non-coding upstream 363 6245683 ~ 6245975 (+)
G155041 NA non-coding upstream 82421 6163680 ~ 6163917 (+)
G155032 NA non-coding upstream 82946 6162651 ~ 6163392 (+)
G154997 NA non-coding upstream 146149 6099762 ~ 6100189 (+)
G154996 NA non-coding upstream 152160 6079615 ~ 6094178 (+)
G155072 NA non-coding downstream 15532 6262175 ~ 6262474 (+)
G155087 NA non-coding downstream 76448 6323091 ~ 6334951 (+)
G155110 NA non-coding downstream 95905 6342548 ~ 6342771 (+)
G155121 NA non-coding downstream 134824 6381467 ~ 6381786 (+)
G155124 NA non-coding downstream 138121 6384764 ~ 6385040 (+)
CI01000029_05461497_05468985 BATF other upstream 775992 5461497 ~ 5470346 (+)
G154587 NA other upstream 974803 5271020 ~ 5271535 (+)
G153790 NA other upstream 1506231 4733589 ~ 4740107 (+)
G153475 NA other upstream 2684334 3545125 ~ 3562004 (+)
G152451 NA other upstream 3483399 2761594 ~ 2762939 (+)
G155079 NA other downstream 36042 6282685 ~ 6288398 (+)
G155083 NA other downstream 184892 6431535 ~ 6490294 (+)
CI01000029_06906861_06907157 NA other downstream 659545 6905834 ~ 6908633 (+)
G155522 NA other downstream 1388190 7634833 ~ 7637834 (+)
G155627 NA other downstream 1684837 7931480 ~ 7932177 (+)

Expression


Co-expression Network