CI01000034_00643011_00645310 (RBX1)


Basic Information

Item Value
gene id CI01000034_00643011_00645310
gene name RBX1
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 642901 ~ 645310 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000034_00643011_00645310.mRNA
CTATAAAGACACGCAGTATTGCTCTATTTTAATGATAACCTATCGCTGATTACTAAACTGAGGAACGACGCGATCTCCCTAACTCTCGCGAGATCAGGCCATTAGCAAACATGGCGGCCGCGATGGATGTGGACACCCCGAGTGGAACCAACAGTGGAGCCAGTAAGAAGCGTTTTGAAGTGAAAAAGTGGAATGCAGTGGCTCTGTGGGCTTGGGACATTGTGGTGGACAACTGTGCCATTTGTAGAAATCACATTATGGACCTCT

Function

symbol description
rbx1 Predicted to enable cullin family protein binding activity and ubiquitin protein ligase activity. Predicted to be involved in protein ubiquitination and ubiquitin-dependent protein catabolic process. Predicted to be part of cullin-RING ubiquitin ligase complex. Predicted to be active in nucleus. Is expressed in female organism. Orthologous to human RBX1 (ring-box 1).

GO:

id name namespace
GO:0045116 protein neddylation biological_process

KEGG:

id description
K03868 RBX1, ROC1; E3 ubiquitin-protein ligase RBX1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000034_00643011_00645310.mRNA False 267 mRNA 0.48 2 642901 645310

Neighbor

gene id symbol gene type direction distance location
CI01000034_00637189_00642362 NA coding upstream 462 636970 ~ 642439 (+)
CI01000034_00615867_00624387 MIEF1 coding upstream 17583 614958 ~ 625820 (+)
CI01000034_00545816_00547683 NA coding upstream 94387 545816 ~ 548514 (+)
CI01000034_00520790_00525323 DDX5 coding upstream 117328 520672 ~ 525573 (+)
CI01000034_00486238_00516732 SMURF2 coding upstream 125377 486238 ~ 517524 (+)
CI01000034_00661553_00677752 XPP3, XPNPEP3 coding downstream 16243 661553 ~ 679148 (+)
CI01000034_00683973_00725610 EP300, EP300B coding downstream 38663 683973 ~ 725905 (+)
CI01000034_00735558_00738466 DESI1A, DESI1 coding downstream 90177 735487 ~ 739475 (+)
CI01000034_00785411_00801907 NA coding downstream 139235 784545 ~ 803844 (+)
CI01000034_00821815_00825192 NA coding downstream 175285 820595 ~ 825205 (+)
G169181 NA non-coding upstream 12352 626550 ~ 630549 (+)
G169215 NA non-coding upstream 29662 612436 ~ 613239 (+)
G169221 NA non-coding upstream 52702 589854 ~ 590199 (+)
G169220 NA non-coding upstream 54757 587903 ~ 588144 (+)
G169174 NA non-coding upstream 83660 557107 ~ 559241 (+)
G169205 NA non-coding downstream 87305 732615 ~ 733448 (+)
G169203 NA non-coding downstream 88445 733755 ~ 734093 (+)
G169245 NA non-coding downstream 118576 763886 ~ 764116 (+)
G169309 NA other downstream 323951 969261 ~ 969921 (+)
G169357 NA other downstream 458230 1053543 ~ 1119019 (+)
G169394 NA other downstream 504987 1150297 ~ 1193560 (+)
G169340 NA other downstream 604909 1250219 ~ 1310878 (+)
CI01000034_01729413_01730790 EVE1 other downstream 1081200 1729413 ~ 1731179 (+)

Expression


Co-expression Network