G171867



Basic Information


Item Value
gene id G171867
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 2095850 ~ 2096308 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU195256
TTTTATCTAAAGAAGTAGAAAGCCAAACTGGGGTGACTATTTCCCGTGACACAATCTAGAGTTTGCCAGGGCCCATGCTGACAAAGATGAAGACTACTGGGACTCTACACTCTGGAGTGATGAGACCAAGATAAATGTTTTTGGAACTGATGGCTTCAAAACTGTATGGCGTCGCAAAGGTGAGGAATACAAAGAAAAATGCATGGTGCCTACAGTGAAACATGGTGGTGGCAGTGTCCTTATGTGGGGCTGCATGAGTGCTGCTGGTGTCGGGGAGCTGCATTTCATTGATGGCATCATGAATTCACAGATGTACTGCTCTATACTGAAAGAGAAGATGCTACCATCACCCCGTGCCTTTGGTCGTCGTGCAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU195256 True 374 lncRNA 0.47 2 2095850 2096308

Neighbor


gene id symbol gene type direction distance location
CI01000034_02092229_02092596 GNGT2, GNGT2A coding downstream 3208 2091959 ~ 2092642 (-)
CI01000034_02010544_02026521 NA coding downstream 69125 2010142 ~ 2026725 (-)
CI01000034_01957876_01995623 NA coding downstream 100034 1957876 ~ 1995816 (-)
CI01000034_01842093_01847705 NR1D1 coding downstream 248145 1840937 ~ 1847705 (-)
CI01000034_01785791_01788743 NA coding downstream 306035 1785235 ~ 1789815 (-)
CI01000034_02098976_02103261 NA coding upstream 1295 2097603 ~ 2103261 (-)
CI01000034_02110958_02136112 NA coding upstream 14638 2110946 ~ 2136112 (-)
CI01000034_02154099_02162106 NAGS coding upstream 56287 2152595 ~ 2162106 (-)
CI01000034_02166509_02170478 NA coding upstream 69693 2166001 ~ 2170478 (-)
CI01000034_02171666_02177554 LSM12A, LSM12 coding upstream 75296 2171604 ~ 2178398 (-)
G171860 NA non-coding downstream 20944 2074696 ~ 2074906 (-)
G171815 NA non-coding downstream 134201 1959454 ~ 1961649 (-)
G171745 NA non-coding downstream 142486 1952910 ~ 1953364 (-)
G171748 NA non-coding downstream 143072 1952458 ~ 1952778 (-)
G171743 NA non-coding downstream 143484 1950142 ~ 1952366 (-)
G171849 NA non-coding upstream 66959 2163267 ~ 2165434 (-)
G171841 NA non-coding upstream 306785 2403093 ~ 2428544 (-)
G171890 NA non-coding upstream 446855 2543163 ~ 2543769 (-)
G171907 NA non-coding upstream 493236 2589544 ~ 2589761 (-)
G171937 NA non-coding upstream 573848 2670156 ~ 2670385 (-)
G171755 NA other downstream 229477 1864118 ~ 1866373 (-)
CI01000034_01312431_01312780 PRR15LA other downstream 777596 1311529 ~ 1312780 (-)
CI01000034_01062505_01083413 NA other downstream 1018628 1062444 ~ 1083413 (-)
CI01000034_00571856_00577732 NA other downstream 1511567 571856 ~ 577775 (-)
G171229 NA other downstream 1828604 229404 ~ 267246 (-)
G171835 NA other upstream 345513 2441821 ~ 2446293 (-)
CI01000034_02510595_02511512 NA other upstream 413505 2510061 ~ 2511521 (-)
G172016 NA other upstream 1138655 3234963 ~ 3236615 (-)
G172151 NA other upstream 1295205 3391144 ~ 3451802 (-)
CI01000034_04165535_04172272 KCTD13 other upstream 2070191 4165373 ~ 4172272 (-)

Expression



Co-expression Network