G171937



Basic Information


Item Value
gene id G171937
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 2670156 ~ 2670385 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU195349
TGTCATCCTCCCATTCCCATACAGTCTAGGGGCCTAGAGCATATATAGGGAACAGAAAAATACACAACTACCCGGACTTGGTCAGGGCCGTAGACAAAGTTTCATAAGCTGGTCACATTGGTGAGGCTTATGCAGAGAGAACCTGTGTTTGCAACGCAGGAACGTCTAGGTTACAAAACCTGACAACCTGACCGCCTCACAGATTTCCGCGATGGACACGCCAGTGGACC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU195349 True 230 lncRNA 0.50 1 2670156 2670385

Neighbor


gene id symbol gene type direction distance location
CI01000034_02596578_02625089 SCN4AB coding downstream 44749 2596169 ~ 2625407 (-)
CI01000034_02585852_02587541 GH1 coding downstream 82615 2585632 ~ 2587541 (-)
CI01000034_02581924_02584745 NA coding downstream 85411 2581579 ~ 2584745 (-)
CI01000034_02575638_02577407 NA coding downstream 92584 2575344 ~ 2577572 (-)
CI01000034_02513892_02532734 ARHGAP27L coding downstream 137422 2513878 ~ 2532734 (-)
CI01000034_02673701_02680445 NA coding upstream 3136 2673521 ~ 2680753 (-)
CI01000034_02712912_02755978 KANSL1B coding upstream 42302 2712687 ~ 2755978 (-)
CI01000034_02778206_02786310 CDC27 coding upstream 107315 2777700 ~ 2786310 (-)
CI01000034_02875948_02953386 CRHR2, CRHR1 coding upstream 205273 2875658 ~ 2954520 (-)
CI01000034_03247806_03248810 NA coding upstream 577409 3247794 ~ 3248947 (-)
G171907 NA non-coding downstream 80395 2589544 ~ 2589761 (-)
G171890 NA non-coding downstream 126387 2543163 ~ 2543769 (-)
G171841 NA non-coding downstream 241612 2403093 ~ 2428544 (-)
G171849 NA non-coding downstream 504722 2163267 ~ 2165434 (-)
G171867 NA non-coding downstream 573848 2095850 ~ 2096308 (-)
G171939 NA non-coding upstream 470 2670855 ~ 2671069 (-)
G171926 NA non-coding upstream 9293 2679678 ~ 2735927 (-)
G171920 NA non-coding upstream 95705 2766090 ~ 2774240 (-)
G171927 NA non-coding upstream 105555 2775940 ~ 2776384 (-)
G171946 NA non-coding upstream 124773 2795158 ~ 2795444 (-)
CI01000034_02510595_02511512 NA other downstream 158635 2510061 ~ 2511521 (-)
G171835 NA other downstream 223863 2441821 ~ 2446293 (-)
G171755 NA other downstream 803783 1864118 ~ 1866373 (-)
CI01000034_01312431_01312780 PRR15LA other downstream 1351902 1311529 ~ 1312780 (-)
CI01000034_01062505_01083413 NA other downstream 1592934 1062444 ~ 1083413 (-)
G172016 NA other upstream 564578 3234963 ~ 3236615 (-)
G172151 NA other upstream 721128 3391144 ~ 3451802 (-)
CI01000034_04165535_04172272 KCTD13 other upstream 1496114 4165373 ~ 4172272 (-)
CI01000034_04216451_04218876 NA other upstream 1545827 4216212 ~ 4221881 (-)
G172593 NA other upstream 2322575 4992960 ~ 4994943 (-)

Expression



Co-expression Network