G176635


Basic Information

Item Value
gene id G176635
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000037
NCBI id null
chromosome length 4612320
location 3868213 ~ 3868430 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU200628
GTAATATATTATTGCAGTTTAAAACAACTCATGTCGTGTTATTCCTGTGATGTAAAGCTGAATTTTTAGCATCATTACTCCAGTCTTCACAGTCACATGATCCTTTAGAAATCATTCTAATATGCTGATTTGCTCAAGAAACATTTCTTATTATTATCAATGTTGAAAACAGTTGTGCTGCTTAATATATAGTAGTCAACATTTGAAGTGGATCAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU200628 True 218 lncRNA 0.30 1 3868213 3868430

Neighbor

gene id symbol gene type direction distance location
CI01000037_03855991_03860283 UBE2A.L, UBE2A, UBE2B, UBE2AL, BRAFLDRAFT_128294 coding upstream 6912 3855991 ~ 3861301 (+)
CI01000037_03824405_03854894 ANKRD10B coding upstream 13019 3824208 ~ 3855194 (+)
CI01000037_03811261_03823037 CARKD coding upstream 45098 3811261 ~ 3823115 (+)
CI01000037_03804670_03806154 NA coding upstream 61745 3803977 ~ 3806468 (+)
CI01000037_03761579_03791584 NA coding upstream 76158 3761579 ~ 3792055 (+)
CI01000037_03875808_03891566 NA coding downstream 7058 3875488 ~ 3892387 (+)
CI01000037_03901647_03902747 NA coding downstream 30969 3899399 ~ 3902747 (+)
CI01000037_03946645_03954021 SIK1 coding downstream 77565 3945995 ~ 3954314 (+)
CI01000037_04050140_04050646 NA coding downstream 180735 4049165 ~ 4050883 (+)
CI01000037_04061560_04065802 NA coding downstream 193130 4061560 ~ 4066041 (+)
G176633 NA non-coding upstream 1093 3866842 ~ 3867120 (+)
G176554 NA non-coding upstream 310831 3557182 ~ 3557382 (+)
G176510 NA non-coding upstream 322463 3545289 ~ 3545750 (+)
G176509 NA non-coding upstream 325436 3542560 ~ 3542777 (+)
G176507 NA non-coding upstream 327161 3540725 ~ 3541052 (+)
G176636 NA non-coding downstream 368 3868798 ~ 3869005 (+)
G176649 NA non-coding downstream 41185 3909615 ~ 3909911 (+)
G176652 NA non-coding downstream 45520 3913950 ~ 3915351 (+)
G176519 NA non-coding downstream 62551 3930981 ~ 4010044 (+)
G176672 NA non-coding downstream 151017 4019447 ~ 4019931 (+)
G176377 NA other upstream 780245 2976862 ~ 3087968 (+)
G176346 NA other upstream 1028160 2839760 ~ 2840053 (+)
CI01000037_01965864_01966433 COA5, CB064 other upstream 1897822 1965603 ~ 1966435 (+)
G174949 NA other upstream 2253939 1613876 ~ 1614274 (+)
CI01000037_04213179_04218057 NA other downstream 344853 4212907 ~ 4218305 (+)

Expression


Co-expression Network