G183151


Basic Information

Item Value
gene id G183151
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 7496060 ~ 7496326 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU207980
CAAAATCATGTGATTTGATTAAATGAGGCTTCGTTATGTCATAAGTGTTTCGAAATTTCAATAGTTCACTTGACTTTGGCAGTTTGATACACGCTCCGAACCACTGATTCAAAACAAAATATTCGTAAAGCTTCAAAGCTTCATGAAGCAGTGTTTTGAAATTGCCCATCACTAGAAACTAGGAATGCACCGATACCATTTTTTAAGGACCGAGTACGAGTACCGATATTTTTTTCTGGTACTCGCTGATACCGATACCGATGCCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU207980 True 267 lncRNA 0.38 1 7496060 7496326

Neighbor

gene id symbol gene type direction distance location
CI01000039_07450597_07454594 NA coding downstream 41430 7449808 ~ 7454630 (-)
CI01000039_07401817_07402410 H3F3AP4, H3F3C, H3F3B, H3F3A, GM6421 coding downstream 93421 7400571 ~ 7402639 (-)
CI01000039_07385848_07389331 KPTN coding downstream 105570 7384829 ~ 7390490 (-)
CI01000039_07320926_07323244 CKM, CKM.S, CKMA, CKM2 coding downstream 171407 7320717 ~ 7324653 (-)
CI01000039_07165860_07166458 RHOG, RHOGC coding downstream 329602 7164783 ~ 7166458 (-)
CI01000039_07498583_07505779 NA coding upstream 2177 7498503 ~ 7506602 (-)
CI01000039_07523213_07573865 LRCH2 coding upstream 26871 7523197 ~ 7576151 (-)
CI01000039_07592640_07593317 NA coding upstream 96222 7592548 ~ 7595053 (-)
CI01000039_07619613_07632295 WDR44 coding upstream 122554 7618880 ~ 7632295 (-)
CI01000039_07658015_07658757 NA coding upstream 161214 7657540 ~ 7659052 (-)
G183150 NA non-coding downstream 49 7495765 ~ 7496011 (-)
G183143 NA non-coding downstream 10575 7485119 ~ 7485485 (-)
G183142 NA non-coding downstream 11252 7484577 ~ 7484808 (-)
G183140 NA non-coding downstream 14067 7481633 ~ 7481993 (-)
G183135 NA non-coding downstream 30870 7463121 ~ 7465190 (-)
G183154 NA non-coding upstream 98798 7595124 ~ 7595358 (-)
G183212 NA non-coding upstream 238217 7734543 ~ 7734910 (-)
G183214 NA non-coding upstream 274103 7770429 ~ 7775182 (-)
G183231 NA non-coding upstream 280402 7776728 ~ 7777392 (-)
G183232 NA non-coding upstream 282005 7778331 ~ 7778642 (-)
CI01000039_07134422_07137732 NA other downstream 358293 7134422 ~ 7137767 (-)
CI01000039_06647926_06651530 NA other downstream 847484 6646544 ~ 6653449 (-)
G182827 NA other downstream 860860 6634547 ~ 6635200 (-)
G182771 NA other downstream 987627 6507955 ~ 6508433 (-)
G182470 NA other downstream 1859296 5636058 ~ 5636764 (-)
G183261 NA other upstream 475790 7972116 ~ 7975045 (-)

Expression


Co-expression Network