G199196


Basic Information

Item Value
gene id G199196
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 6736328 ~ 6736528 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU226094
GTGATTTTGGCGTTCGCTTGTACGGTGGCTCTGAATTGCCAAAACGTCTCTCAAAATGTGTGCCACGGATGCGAAAAATGCAGAAAATCAAACCTGATCTGAATTTTTTTTATGATGGATGAAAGTTTCGGAGGCAGTGTGTAAATGTGATTGACACAATATGAGGTCGTATTTATTTTTTAACGTGCGAAAATTTGGGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU226094 True 201 lncRNA 0.39 1 6736328 6736528

Neighbor

gene id symbol gene type direction distance location
CI01000046_06702303_06713022 PPL coding downstream 23306 6701808 ~ 6713022 (-)
CI01000046_06685686_06699338 GLYR1 coding downstream 36990 6685330 ~ 6699338 (-)
CI01000046_06676701_06682877 ROGDI coding downstream 51505 6675979 ~ 6684823 (-)
CI01000046_06664434_06673031 COG1 coding downstream 62793 6663560 ~ 6673535 (-)
CI01000046_06619452_06652257 GNA13, GNA13.S coding downstream 84071 6619166 ~ 6652257 (-)
CI01000046_06776591_06785540 RRN3 coding upstream 39737 6776265 ~ 6785540 (-)
CI01000046_06788374_06788841 NA coding upstream 51347 6787875 ~ 6788909 (-)
CI01000046_06832925_06846425 MYH11B, MYH11 coding upstream 95589 6832117 ~ 6846515 (-)
CI01000046_06872592_06887834 ABCC6B.2 coding upstream 136064 6872592 ~ 6887834 (-)
CI01000046_06903575_06906579 NA coding upstream 167019 6903547 ~ 6906933 (-)
G199157 NA non-coding downstream 35293 6699791 ~ 6701035 (-)
G199139 NA non-coding downstream 125244 6607855 ~ 6611084 (-)
G199130 NA non-coding downstream 142118 6577980 ~ 6594210 (-)
G199128 NA non-coding downstream 164307 6571716 ~ 6572021 (-)
G199126 NA non-coding downstream 166361 6569560 ~ 6569967 (-)
G199201 NA non-coding upstream 10432 6746960 ~ 6755212 (-)
G199209 NA non-coding upstream 27924 6764452 ~ 6767009 (-)
G199191 NA non-coding upstream 64101 6800629 ~ 6819784 (-)
G199161 NA non-coding upstream 72136 6808664 ~ 6812370 (-)
G199182 NA non-coding upstream 78659 6815187 ~ 6817882 (-)
G199014 NA other downstream 360922 6364178 ~ 6375406 (-)
G199054 NA other downstream 638654 6097359 ~ 6097674 (-)
G198265 NA other downstream 2936227 3665243 ~ 3800101 (-)
CI01000046_02866255_02867695 MRM2, FTSJ2 other downstream 3868534 2866070 ~ 2867794 (-)
G199181 NA other upstream 90157 6826685 ~ 6830453 (-)

Expression


Co-expression Network