G217847


Basic Information

Item Value
gene id G217847
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 1220156 ~ 1220397 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU247118
GGATTACATAGTAAGCGCTATAATTTTCAGATATTAGTAAACAAGTGTTTAAGAGAATATTGTTTTGCAGGATATCACAGTGATGTATGATAGATTAATAGTGAAGTCTGTAGTTTGAGAGGATATGTTATTTATAAGGAATATAATTATATTTTAAAAATTAATTTTTTTTTTAAAAAGTCATAGCTTGTGGGGTAAAACGCCCCCTACGCTGAGGATTAAAACGCCCCCCCAGAGGCGAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU247118 True 242 lncRNA 0.32 1 1220156 1220397

Neighbor

gene id symbol gene type direction distance location
CI01000051_00775546_00780498 PSMA8 coding upstream 439599 775374 ~ 780557 (+)
CI01000051_00750280_00751344 GPR132B coding upstream 466313 750158 ~ 753843 (+)
CI01000051_00729622_00743172 NA coding upstream 476916 729622 ~ 743240 (+)
CI01000051_00638200_00720543 CDC42BPB coding upstream 499613 637590 ~ 720669 (+)
CI01000051_00514656_00517593 ENPP5 coding upstream 702142 513815 ~ 518014 (+)
CI01000051_01335061_01337004 NA coding downstream 114155 1334552 ~ 1339091 (+)
CI01000051_01367599_01369326 NA coding downstream 147042 1367439 ~ 1369436 (+)
CI01000051_01401065_01414909 NA coding downstream 179320 1399717 ~ 1415932 (+)
CI01000051_01419542_01436241 NA coding downstream 198652 1419049 ~ 1436331 (+)
CI01000051_01439230_01450774 NA coding downstream 218046 1438443 ~ 1451260 (+)
G217845 NA non-coding upstream 1088 1218783 ~ 1219068 (+)
G217830 NA non-coding upstream 24454 1195450 ~ 1195702 (+)
G217812 NA non-coding upstream 41885 1178026 ~ 1178271 (+)
CI01000051_01171125_01232233 NA non-coding upstream 48038 1171009 ~ 1232563 (+)
G217797 NA non-coding upstream 51100 1168817 ~ 1169056 (+)
G217893 NA non-coding downstream 244856 1465253 ~ 1468791 (+)
G217934 NA non-coding downstream 270265 1490662 ~ 1490879 (+)
G217936 NA non-coding downstream 295260 1515657 ~ 1515909 (+)
G217946 NA non-coding downstream 330306 1550703 ~ 1569213 (+)
G217075 NA other upstream 836028 324465 ~ 384128 (+)
CI01000051_02060996_02061735 NA other downstream 839590 2060534 ~ 2062355 (+)
G218981 NA other downstream 2025046 3245443 ~ 3246873 (+)
CI01000051_04374052_04393328 NA other downstream 3154013 4372658 ~ 4393677 (+)
G219803 NA other downstream 3694577 4914974 ~ 5052033 (+)
CI01000051_06825895_06830637 NA other downstream 5605402 6825895 ~ 6830637 (+)

Expression


Co-expression Network