G221822


Basic Information

Item Value
gene id G221822
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5978741 ~ 5978996 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU251603
TTTTACCCTCATGTTATCTGATATGTATACGACTGACCTTCTTAAGATAAACACAAAAAAAGGTTTTTAGAAAAAAATAATCTCTGGGAATGCTTTATGCAAGCTCATGTGTTCCTAAAAGTCGAAGCATTAAACAGCACATACAGCAATAACTACAGTAATCCACACTACCCCAATGGATGAATCAATGTCTTCTGAAGTGAAACGATACGTATTTGTAAGAAAAATACCAAATATTTTAAAATTTTAAACTTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU251603 True 256 lncRNA 0.31 1 5978741 5978996

Neighbor

gene id symbol gene type direction distance location
CI01000051_05949486_05950751 KCNS3B coding downstream 27888 5949343 ~ 5950853 (-)
CI01000051_05752434_05755144 NA coding downstream 223597 5752290 ~ 5755144 (-)
CI01000051_05743847_05749675 BPNT1 coding downstream 229066 5743671 ~ 5749675 (-)
CI01000051_05690134_05690418 NA coding downstream 288323 5689547 ~ 5690418 (-)
CI01000051_05679116_05685755 KCNK5B coding downstream 292785 5678771 ~ 5685956 (-)
CI01000051_06015846_06019716 RD3 coding upstream 36711 6015707 ~ 6019716 (-)
CI01000051_06033224_06041180 SLC30A1A coding upstream 54046 6033042 ~ 6041180 (-)
CI01000051_06041891_06047349 NEK2 coding upstream 62623 6041619 ~ 6047710 (-)
CI01000051_06052696_06090422 LPGAT1 coding upstream 72057 6051053 ~ 6090422 (-)
CI01000051_06175507_06185039 NA coding upstream 196483 6175479 ~ 6185039 (-)
G221804 NA non-coding downstream 30085 5948420 ~ 5948656 (-)
G221780 NA non-coding downstream 68993 5855672 ~ 5909748 (-)
G221745 NA non-coding downstream 210149 5768371 ~ 5768592 (-)
G221744 NA non-coding downstream 215769 5762651 ~ 5762972 (-)
G221742 NA non-coding downstream 219406 5759113 ~ 5759335 (-)
G221825 NA non-coding upstream 5367 5984363 ~ 5987132 (-)
G221830 NA non-coding upstream 38637 6017633 ~ 6017970 (-)
G221836 NA non-coding upstream 121563 6100559 ~ 6100763 (-)
G221837 NA non-coding upstream 122726 6101722 ~ 6102002 (-)
G221858 NA non-coding upstream 215664 6194660 ~ 6194895 (-)
G221575 NA other downstream 459917 5513952 ~ 5518824 (-)
G220041 NA other downstream 1820638 4155730 ~ 4158103 (-)
CI01000051_02955633_02960400 SCRN2 other downstream 3017247 2955380 ~ 2961148 (-)
G218861 NA other downstream 3138109 2840270 ~ 2840632 (-)
G218728 NA other downstream 3432282 2527343 ~ 2546459 (-)
G221840 NA other upstream 153777 6132773 ~ 6133579 (-)
G222729 NA other upstream 2363153 8342149 ~ 8342652 (-)
G222730 NA other upstream 2363974 8342970 ~ 8343438 (-)

Expression


Co-expression Network