G221830


Basic Information

Item Value
gene id G221830
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 6017633 ~ 6017970 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU251611
AATTTCTACATTTCAAAATGTCTTTGAATTCTGTTTTCTATGTGTATCATGTTATAATCATTCAGCTATCATATTGTTACAGTACAGTACAAAATATTGACCATTTTCAAATCTCTTTTTAACCCTAACAATTAAAGATACAGTGGTTACATTTTTGTCACTGTACATAGGTATGTAATAGGCCTCAGTTATGATTGGCTAACCTTTTTGCGTGTGAAATGAGTAACAAAACTCACTTACAGCCAGGGGGCCTCCTGTCTGACCAGGGCCCTTAGAATCATCCAAATCTTCACATATTATTATACACATCTCAAATAGCTCAAATAGTTACATACACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU251611 True 338 lncRNA 0.34 1 6017633 6017970

Neighbor

gene id symbol gene type direction distance location
CI01000051_05949486_05950751 KCNS3B coding downstream 66780 5949343 ~ 5950853 (-)
CI01000051_05752434_05755144 NA coding downstream 262489 5752290 ~ 5755144 (-)
CI01000051_05743847_05749675 BPNT1 coding downstream 267958 5743671 ~ 5749675 (-)
CI01000051_05690134_05690418 NA coding downstream 327215 5689547 ~ 5690418 (-)
CI01000051_05679116_05685755 KCNK5B coding downstream 331677 5678771 ~ 5685956 (-)
CI01000051_06033224_06041180 SLC30A1A coding upstream 15072 6033042 ~ 6041180 (-)
CI01000051_06041891_06047349 NEK2 coding upstream 23649 6041619 ~ 6047710 (-)
CI01000051_06052696_06090422 LPGAT1 coding upstream 33083 6051053 ~ 6090422 (-)
CI01000051_06175507_06185039 NA coding upstream 157509 6175479 ~ 6185039 (-)
CI01000051_06189714_06192740 NA coding upstream 171642 6189612 ~ 6192740 (-)
G221825 NA non-coding downstream 30501 5984363 ~ 5987132 (-)
G221822 NA non-coding downstream 38637 5978741 ~ 5978996 (-)
G221804 NA non-coding downstream 68977 5948420 ~ 5948656 (-)
G221780 NA non-coding downstream 107885 5855672 ~ 5909748 (-)
G221745 NA non-coding downstream 249041 5768371 ~ 5768592 (-)
G221836 NA non-coding upstream 82589 6100559 ~ 6100763 (-)
G221837 NA non-coding upstream 83752 6101722 ~ 6102002 (-)
G221858 NA non-coding upstream 176690 6194660 ~ 6194895 (-)
G221890 NA non-coding upstream 378811 6396781 ~ 6396987 (-)
G222054 NA non-coding upstream 645638 6663608 ~ 6689905 (-)
G221575 NA other downstream 498809 5513952 ~ 5518824 (-)
G220041 NA other downstream 1859530 4155730 ~ 4158103 (-)
CI01000051_02955633_02960400 SCRN2 other downstream 3056139 2955380 ~ 2961148 (-)
G218861 NA other downstream 3177001 2840270 ~ 2840632 (-)
G218728 NA other downstream 3471174 2527343 ~ 2546459 (-)
G221840 NA other upstream 114803 6132773 ~ 6133579 (-)
G222729 NA other upstream 2324179 8342149 ~ 8342652 (-)
G222730 NA other upstream 2325000 8342970 ~ 8343438 (-)

Expression


Co-expression Network