XLOC_009758 (il11a)


Basic Information

Item Value
gene id XLOC_009758
gene name il11a
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 12611362 ~ 12617155 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00019521
TCCACAGTGCTGGGTGACTCCTCCTCATCGCTGCTTCTCTCGCTGCTGCTGGCTCAACTACATTTGTTAGCATCTGCCTTCCCTGTCCATCACCGGCGGAACCAGATCGACTTCGACAAGCTGAGCAATCAGACCAAACTCCTTCTGACGCTGACTCGGAATCTATTGAAAGACCGGGTGTTTAGTACAGAGATTAATCATCACCGGTTCAAGTCTCTTCCAGCAATCAGCAGCAGAGCCAGTGACTTCGCAACTCTAGAGGTCAAGCCTACTCTTTCTCAGCTCCATGCAAACCTCAAGTCCTTCCAGCACCATTTTGAGTGGCTGAACAACATAACACACAAGCAGCAGCACAGCATACCAAAGCTGACAGACATGGTCTCCCACATCGGGGGACTCGTAAACTCTTTACAGCGCCAGATGAACCACATAGGGGCTCCCCGACTCACAGTTCCCTCCCCCTCACTCCCACCCATTCCCGCCTTTCACTGGGAGATGGTTCAGACCTCTCAGGAGCTCCTGGAACAGTTCTCGCTCTTCTGTGACTGGGCCGCTCGAGTGTTGGGCAGGACGCGGTCTTTATTAACCTCTAGAGAAGCACCGGTCGTAGGAAGCACCGGGACATCTCCCAGTGGGCCGATTCGAATTGTGGGGAAATAG

Function

symbol description
il11a Predicted to enable cytokine activity and growth factor activity. Predicted to be involved in positive regulation of MAPK cascade and positive regulation of cell population proliferation. Predicted to be active in cytoplasm. Orthologous to human IL11 (interleukin 11).

GO:

id name namespace
GO:0043410 positive regulation of MAPK cascade biological_process
GO:0008284 positive regulation of cell population proliferation biological_process
GO:0005737 cytoplasm cellular_component
GO:0005125 cytokine activity molecular_function
GO:0008083 growth factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-051019-1 Predicted to enable cytokine activity and growth factor activity. Predicted to be involved in positive regulation of MAPK cascade and positive regulation of cell population proliferation. Predicted to be active in cytoplasm. Orthologous to human IL11 (interleukin 11).

Ensembl:

ensembl_id ENSDARG00000037859

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00019521 True 660 mRNA 0.53 4 12611362 12617155

Neighbor

gene id symbol gene type direction distance location
XLOC_009757 rasip1 coding upstream 50640 12517535 ~ 12560722 (+)
XLOC_009756 CR388102.6 coding upstream 230516 12380730 ~ 12380846 (+)
XLOC_009755 CR388102.1 coding upstream 311076 12300169 ~ 12300286 (+)
XLOC_009754 si:dkey-26c10.5 coding upstream 316894 12281032 ~ 12294468 (+)
XLOC_009753 zgc:92606 coding upstream 335137 12265158 ~ 12276225 (+)
XLOC_009759 nat14 coding downstream 15273 12632428 ~ 12639753 (+)
XLOC_009760 aicda coding downstream 43322 12660477 ~ 12665652 (+)
XLOC_009761 epn1 coding downstream 113156 12730311 ~ 12756528 (+)
XLOC_009762 u2af2a coding downstream 195059 12812214 ~ 12821768 (+)
XLOC_009763 cacng6b coding downstream 218988 12836143 ~ 12866551 (+)
XLOC_009751 NA non-coding upstream 472026 12117631 ~ 12139336 (+)
XLOC_009737 NA non-coding upstream 1027484 11580652 ~ 11583878 (+)
XLOC_009736 NA non-coding upstream 1032955 11573189 ~ 11578407 (+)
XLOC_009764 NA non-coding downstream 345805 12962960 ~ 12963877 (+)
XLOC_009765 NA non-coding downstream 495109 13112264 ~ 13115609 (+)
XLOC_009766 NA non-coding downstream 551717 13168872 ~ 13172698 (+)
XLOC_009768 NA non-coding downstream 882206 13499361 ~ 13501965 (+)
XLOC_009769 NA non-coding downstream 995499 13612654 ~ 13614188 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000016_05381573_05383796 NA coding CI01000016 null 5380917 ~ 5383818 (+)