G228845


Basic Information

Item Value
gene id G228845
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 6124498 ~ 6124752 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU259687
CTTCGTTGATCTTCGGAACACAAATTAAGATATTTTTGTTGAAATCCGATGGCTCAGTGAGGCCTACATAGGGAGCAATGACATTTCCTCTCTCAAGATCCATAAAGGTACTAAAAACATATTTAAATCAGTTCATGTGAGTACAGTGGTTCAATATTAATATTATAAAGTGACAAGAATATTTTTGGTGCGCCAAAAAAAACAAAATAAGGACTTATTTAGTGATGGCCGATTTCAAAACACTGCTTCAGGAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU259687 True 255 lncRNA 0.35 1 6124498 6124752

Neighbor

gene id symbol gene type direction distance location
CI01000053_06095365_06103392 OLFML2A coding upstream 20465 6095365 ~ 6104033 (+)
CI01000053_06050344_06056286 NA coding upstream 67849 6050344 ~ 6056649 (+)
CI01000053_06046867_06049295 NA coding upstream 75203 6046867 ~ 6049295 (+)
CI01000053_05976882_06023460 GPAT2 coding upstream 100807 5976882 ~ 6023691 (+)
CI01000053_05920285_05920932 NA coding upstream 203478 5920093 ~ 5921020 (+)
CI01000053_06130926_06132991 NA coding downstream 6088 6130840 ~ 6133160 (+)
CI01000053_06148375_06153273 ARPC5LA, ARPC5LB, ARPC5L, ARPC5 coding downstream 22930 6147682 ~ 6153805 (+)
CI01000053_06157492_06158741 NA coding downstream 32740 6157492 ~ 6159597 (+)
CI01000053_06182140_06229627 NA coding downstream 57388 6182140 ~ 6230029 (+)
CI01000053_06238623_06241104 NA coding downstream 112804 6237556 ~ 6241866 (+)
G228836 NA non-coding upstream 12555 6111468 ~ 6111943 (+)
G228827 NA non-coding upstream 48300 6075958 ~ 6076198 (+)
G228824 NA non-coding upstream 76826 6047431 ~ 6047672 (+)
G228823 NA non-coding upstream 89719 6034553 ~ 6034779 (+)
G228749 NA non-coding upstream 192104 5932115 ~ 5932394 (+)
G228849 NA non-coding downstream 3531 6128283 ~ 6128592 (+)
G228850 NA non-coding downstream 3943 6128695 ~ 6128923 (+)
G228852 NA non-coding downstream 9195 6133947 ~ 6138928 (+)
G228785 NA non-coding downstream 117559 6242311 ~ 6242952 (+)
G228887 NA non-coding downstream 154054 6278806 ~ 6350119 (+)
CI01000053_05471449_05512831 LRRC75B other upstream 611424 5471449 ~ 5513074 (+)
G228257 NA other upstream 746049 5375553 ~ 5378449 (+)
G227317 NA other upstream 1708905 4414951 ~ 4415593 (+)
G226399 NA other upstream 2426969 3620798 ~ 3697529 (+)
G226347 NA other upstream 2849587 3272374 ~ 3274911 (+)
CI01000053_06725452_06758944 NA other downstream 598447 6725452 ~ 6758944 (+)

Expression


Co-expression Network