G228887



Basic Information


Item Value
gene id G228887
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 6278806 ~ 6350119 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU259736
GTGTAAGAATTGAAAATATCTAAAGATATTTTAAAATGAACAAAGACATTTGCTTTACTGTCTCAACCCCCTCTCTCTTGCTACAAGGGCCGTTTGGAAGGCTCAAAGGTGTTGACAGTGATCAAGCCCTGTAGGCCAAGATGTGTGTACATCGGGGGTCTACAAATGGTCACACCTTTAGTACAGTGGGGGATCTTCTGATTGGTCAGTTTGAATGTCTCACATTTGGGTTTCAGTCACATGGTCAAGGAAGGGATAAAAGAATATTGTAACTGTTGCTCTGGTCTCTTTTATTCTGTCTCTTTGATTCTTGGCTTTTCTTGGGCACTCTCTCTGGCCCTCTCTCTCTCTCTCGCTCTCTCTTTCTCTTTCACTCTCTCTCTCTCTCTATCTCTCAGGTAACTTTTGACATACATGCTGGGTACGATTAATGGTATATGATTTTATCATCTCATACATCTATTTTGTAACTATGTTAAGTGTAACCATAACCAGATATTGTCATTAAACTCTTTCATTTACAAATGATGTGCTAACTAGTTTTGATTTAGTGTTAACATTAATGTGCTCCATATTGCAATACAATATTGTCACACTATAGCAACGCTCTCCCACACATTTTGCTATTGTAACTGCGCTTATTTCCGTCGTTGGTATAAGTTGCAGTGGGTGGTAATAGACAAGAAATGTACAGTTTTCTACCATCTTGCTGATAACGTTTCTTTAGTCGCTCGGTAACCCTACAGCCTGAACCCCTGTAGGAGCTCCACCTTTACAGATGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU259736 True 782 lncRNA 0.40 2 6278806 6350119

Neighbor


gene id symbol gene type direction distance location
CI01000053_06276837_06278780 NA coding upstream 26 6276717 ~ 6278780 (+)
CI01000053_06238623_06241104 NA coding upstream 36940 6237556 ~ 6241866 (+)
CI01000053_06182140_06229627 NA coding upstream 48777 6182140 ~ 6230029 (+)
CI01000053_06157492_06158741 NA coding upstream 119209 6157492 ~ 6159597 (+)
CI01000053_06148375_06153273 ARPC5LA, ARPC5LB, ARPC5L, ARPC5 coding upstream 125001 6147682 ~ 6153805 (+)
CI01000053_06429917_06431273 NA coding downstream 79798 6429917 ~ 6431917 (+)
CI01000053_06554488_06572369 NA coding downstream 202405 6552524 ~ 6572394 (+)
CI01000053_06625828_06650150 NA coding downstream 275709 6625828 ~ 6650150 (+)
CI01000053_06725452_06758944 NA coding downstream 375333 6725452 ~ 6758944 (+)
CI01000053_06851564_06854586 NA coding downstream 501350 6851469 ~ 6854600 (+)
G228785 NA non-coding upstream 35854 6242311 ~ 6242952 (+)
G228852 NA non-coding upstream 139878 6133947 ~ 6138928 (+)
G228850 NA non-coding upstream 149883 6128695 ~ 6128923 (+)
G228849 NA non-coding upstream 150214 6128283 ~ 6128592 (+)
G228845 NA non-coding upstream 154054 6124498 ~ 6124752 (+)
G229012 NA non-coding downstream 273982 6624101 ~ 6624681 (+)
G229026 NA non-coding downstream 307283 6657402 ~ 6657608 (+)
G229028 NA non-coding downstream 308445 6658564 ~ 6659723 (+)
G228909 NA non-coding downstream 309775 6659894 ~ 6660095 (+)
G228899 NA non-coding downstream 310143 6660262 ~ 6662409 (+)
CI01000053_05471449_05512831 LRRC75B other upstream 765732 5471449 ~ 5513074 (+)
G228257 NA other upstream 900357 5375553 ~ 5378449 (+)
G227317 NA other upstream 1863213 4414951 ~ 4415593 (+)
G226399 NA other upstream 2581277 3620798 ~ 3697529 (+)
G226347 NA other upstream 3003895 3272374 ~ 3274911 (+)

Expression



Co-expression Network