CI01000054_11564820_11568338 (S100V2)


Basic Information

Item Value
gene id CI01000054_11564820_11568338
gene name S100V2
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 11564820 ~ 11568999 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000054_11564820_11568338.mRNA
AGTTTTTCCAGAGTGTGGAGCGTATGAAACCCGATCGTCTCCGCCCCGTGAGGTTTACTGTCCTAAAGCATCAAGTTACAGGAGACATTTTTCCCATAGCGGTCACTGACAACGAAGCCATTGCGTTTTATAGGACATTTGAGAACTTTGAAAAACCCTTTTTCGAGGCCTATTCTGACCTTGAGAAGGCCATTAACACCTTGGTCTCAAACTTCCATGCGGCTTCTTCTGATAATCGGCCTACGCTGAAGGCAGATGAGTTCAAGAACCTTCTCTCCTCCCAGATGCCAAACTTAGTCAAGTCGGATCATTTTGGAGAAGTGCTGAAGCAAATGGGTGTGAAAGATGGGGAAGGCATCAGCTTCAAACACTTCTGGAGCCTGATCCAGAACTTGGCCACAACCCAGCATGGTCTGCTGAGCCACGAGAAGTTGTCCAAATGCACCTGTCTGTTACTATGAGCCGCAGACTTAGCTGCATCTACCACTAAGATCTGGTCTCTCTGCATCTCTGCATTTATCCAGAACCACTCATCTCCAAACAAAACACTAACTTTCATTTCTAAACATTACA

Function

symbol description
s100v2 Predicted to enable calcium ion binding activity and calcium-dependent protein binding activity. Predicted to be active in extracellular space and perinuclear region of cytoplasm. Is expressed in gill; gut; and hematopoietic system. Orthologous to several human genes including S100A14 (S100 calcium binding protein A14).

GO:

id name namespace
GO:0005507 copper ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000054_11564820_11568338.mRNA False 573 mRNA 0.46 4 11564820 11568450

Neighbor

gene id symbol gene type direction distance location
CI01000054_11536181_11537063 NA coding upstream 27656 11534757 ~ 11537164 (+)
CI01000054_11409512_11412290 TXNIP, TXNIPA coding upstream 151689 11409254 ~ 11413131 (+)
CI01000054_11289604_11337266 NA coding upstream 227440 11289604 ~ 11337380 (+)
CI01000054_11280613_11285395 NA coding upstream 279425 11280613 ~ 11285395 (+)
CI01000054_11171795_11178974 NA coding upstream 385711 11171731 ~ 11179109 (+)
CI01000054_11600741_11608257 NA coding downstream 32056 11600506 ~ 11608390 (+)
CI01000054_11633235_11635069 PRF1.8 coding downstream 64509 11632959 ~ 11635103 (+)
CI01000054_11637464_11637950 NA coding downstream 68883 11637333 ~ 11638191 (+)
CI01000054_11648262_11648786 NA coding downstream 79509 11647959 ~ 11649495 (+)
CI01000054_11659093_11663413 THAP7 coding downstream 90643 11659093 ~ 11663607 (+)
G236373 NA non-coding upstream 14124 11549604 ~ 11550696 (+)
G236362 NA non-coding upstream 56916 11507425 ~ 11507904 (+)
G236305 NA non-coding upstream 191224 11369095 ~ 11373596 (+)
G236281 NA non-coding upstream 267819 11296149 ~ 11297001 (+)
G236222 NA non-coding upstream 285815 11277411 ~ 11279005 (+)
G236822 NA non-coding downstream 28816 11597266 ~ 11597518 (+)
G236848 NA non-coding downstream 46187 11614637 ~ 11614917 (+)
G236849 NA non-coding downstream 48377 11616827 ~ 11617146 (+)
G236851 NA non-coding downstream 54155 11622605 ~ 11622853 (+)
G235560 NA other upstream 1172442 10388136 ~ 10392378 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other upstream 3235232 8325126 ~ 8329716 (+)
G233306 NA other upstream 3259871 8304599 ~ 8304949 (+)
G233024 NA other upstream 3954927 7567523 ~ 7609893 (+)
G232870 NA other upstream 4676317 6887912 ~ 6888503 (+)
G236874 NA other downstream 245238 11813688 ~ 11816475 (+)
CI01000054_12887165_12901376 NA other downstream 1316452 12886994 ~ 12902006 (+)

Expression


Co-expression Network