G233199


Basic Information

Item Value
gene id G233199
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 7981313 ~ 7981956 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU264623
TTCCATAGATCCTAGAACTATTAGCTGAAGTACCCAGATTTTGCCGTGTTCGCACCGCAGGAACTAGGAACGATTTTAGTTCTAGGAACTCCTTTTGGGGGAACTAAATTAGCTCCTACTTCAGAGTAGGGTCTAAACCAGCACTATAGGAACTATCAGTGACGTAAGTGTACATTGATTGGTTAAACGCATGTCAAACACCAGCACCCGACATTTTTAAAAAGCTGTGTAAACATATTTACTTCACAAACATGGAAAATAGCGATAACAGCATTTACCTGCTGTCTGCAGGGTTGTGTTCTTATCTCTACCTCGATGATATGTAATACTGAAAGTTGTCATAGGAGATTTCGTCTCTTAGCCCCACTTTTTGCTCTTTCAGTCACGTAAATTATGAGTTTACATTCCATCTCCGTTATTATGAAACCCACGACACACAACAAAAACCGCTCCAATCACATCATCCTCCATCCACCGGTTTTTAGTGTTTGTAAATGCCGCACTTAAAGACGCCACTGTCGGCCGCTTCAGAGTTCCTATTCCTGGTGCAAATGCAACCAGGAACGTGACCCGGGGGAGAAATTAGTTCTCGGGGAACTATCCTAGTGGCTAGTTCCTAGAACTATTCGGTGCGAAAGCCCCTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU264623 True 644 lncRNA 0.43 1 7981313 7981956

Neighbor

gene id symbol gene type direction distance location
CI01000054_07852818_07853423 ARL4AB, ARL4A coding upstream 126836 7852401 ~ 7854477 (+)
CI01000054_07836152_07845992 SCIN coding upstream 135081 7835604 ~ 7846232 (+)
CI01000054_07816225_07819805 TMEM106B, T106B, TMEM106BB coding upstream 160338 7816225 ~ 7820975 (+)
CI01000054_07755766_07787767 NA coding upstream 193203 7755766 ~ 7788110 (+)
CI01000054_07726558_07730944 TDP2B, TDP2 coding upstream 250302 7726558 ~ 7731011 (+)
CI01000054_07997892_08012569 BZW2 coding downstream 15936 7997892 ~ 8012883 (+)
CI01000054_08013660_08018583 RBBP7, RBBP4.L, RBBP4.S, RBBP4 coding downstream 31704 8013660 ~ 8018741 (+)
CI01000054_08056620_08072625 NA coding downstream 74550 8056506 ~ 8073345 (+)
CI01000054_08081739_08089067 NA coding downstream 99197 8081153 ~ 8089811 (+)
CI01000054_08149724_08152046 MYCLB coding downstream 166901 8148857 ~ 8152968 (+)
G233198 NA non-coding upstream 145 7980745 ~ 7981168 (+)
G233183 NA non-coding upstream 46676 7934385 ~ 7934637 (+)
G233180 NA non-coding upstream 50243 7930787 ~ 7931070 (+)
G233152 NA non-coding upstream 91503 7889580 ~ 7889810 (+)
G233133 NA non-coding upstream 131859 7849131 ~ 7849454 (+)
G233200 NA non-coding downstream 1643 7983599 ~ 7983836 (+)
G233206 NA non-coding downstream 108565 8090521 ~ 8095560 (+)
G233228 NA non-coding downstream 133643 8115599 ~ 8115863 (+)
G233233 NA non-coding downstream 139140 8121096 ~ 8121700 (+)
G233254 NA non-coding downstream 282362 8264318 ~ 8265518 (+)
G233024 NA other upstream 371420 7567523 ~ 7609893 (+)
G232870 NA other upstream 1092810 6887912 ~ 6888503 (+)
G232659 NA other upstream 1605419 6374850 ~ 6375894 (+)
CI01000054_06305908_06312122 NA other upstream 1674453 6305908 ~ 6312163 (+)
G232558 NA other upstream 1939450 5993660 ~ 6041863 (+)
G233306 NA other downstream 322643 8304599 ~ 8304949 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other downstream 323981 8325126 ~ 8329716 (+)
G235560 NA other downstream 2406180 10388136 ~ 10392378 (+)
CI01000054_11564820_11568338 S100V2 other downstream 3583020 11564820 ~ 11568999 (+)
CI01000054_11633235_11635069 PRF1.8 other downstream 3651020 11632959 ~ 11635103 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) G67907 NA non-coding CM030128.1 CM030128.1 2333491 ~ 2333944 (+)
tiger barb (Puntius tetrazona) G57336 NA non-coding NC_056705.1 CM032074.1 32936302 ~ 32937413 (+)