CI01000299_05419449_05423414 (ATP5J)


Basic Information

Item Value
gene id CI01000299_05419449_05423414
gene name ATP5J
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 5419403 ~ 5423414 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000299_05419449_05423414.mRNA
ATGTGGCAAAAGACGCTAGTGGCGCCATCGCTCGTCATAGGCGTGCGCGGTGACCCGGAAGCACTCAACGTCTGTTCGTCGGTGCCTCGGGTGTCAAACACAAGCATCATGGCTCTTCATCGGCTCTTCCAGCTGTCGTCTCTGTTGGGTTCGGCCGTGCGCGTGACGTTGCGCAGGAACATCGGTCTGTCCGCTGTGCTCTTCAACAAAGCCAAAGACCTGGACCCCGTGCAGAAGCTCTTCCTGGACAAGATTCGCGAGTACAACTCCAAGAGCAAGGCCGTCGCAGGCGGTGTGGTGGATGCCGGCCCGGCCTATCAGAAGAACCTGTCGGATGAGATGACCAAACTACAGCGTTTGTACGGAGGAGGAGATCTGACCAAATTCCCTGAGTTCAGCTTCCCAGAACCCAAACTGGAGGAGGTGACGACTAAATGAACAACGTCTGTCCATCGCTGTCTGTGTGCTGAAAATATTTAATAAA

Function

symbol description
atp5j Predicted to enable proton transmembrane transporter activity. Predicted to contribute to proton-transporting ATP synthase activity, rotational mechanism. Predicted to be involved in several processes, including mitochondrial ATP synthesis coupled proton transport; negative regulation of icosanoid secretion; and positive regulation of heart rate. Predicted to act upstream of or within ion transport. Located in mitochondrial inner membrane. Is expressed in several structures, including alimentary system; central nervous system; genitourinary system; respiratory system; and sensory organ. Orthologous to human ATP5PF (ATP synthase peripheral stalk subunit F6).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000299_05419449_05423414.mRNA True 484 mRNA 0.55 4 5419403 5423414

Neighbor

gene id symbol gene type direction distance location
CI01000299_05379545_05381902 NA coding downstream 37263 5379149 ~ 5382140 (-)
CI01000299_04913779_04927715 NA coding downstream 491688 4913373 ~ 4927715 (-)
CI01000299_04861862_04862244 NA coding downstream 556810 4861577 ~ 4862593 (-)
CI01000299_04741460_04746667 NA coding downstream 672736 4741447 ~ 4746667 (-)
CI01000299_04708767_04714088 RCAN1B coding downstream 705315 4708503 ~ 4714088 (-)
CI01000299_05428160_05443433 APP, APPA coding upstream 4247 5427661 ~ 5443433 (-)
CI01000299_05457285_05462908 NA coding upstream 33693 5456864 ~ 5463491 (-)
CI01000299_05466693_05471714 ADAMTS1 coding upstream 42228 5465642 ~ 5471987 (-)
CI01000299_05478688_05502027 ADAMTS5 coding upstream 54068 5477482 ~ 5503268 (-)
CI01000299_05512316_05521322 NA coding upstream 88637 5512051 ~ 5521322 (-)
G407669 NA non-coding downstream 1032 5413334 ~ 5418371 (-)
G407591 NA non-coding downstream 237041 5085394 ~ 5182362 (-)
G407565 NA non-coding downstream 422494 4957987 ~ 4996909 (-)
G407564 NA non-coding downstream 463038 4956098 ~ 4956365 (-)
G407562 NA non-coding downstream 479464 4939691 ~ 4939939 (-)
G407734 NA non-coding upstream 129214 5552628 ~ 5554845 (-)
G407764 NA non-coding upstream 211426 5634840 ~ 5639866 (-)
G407848 NA non-coding upstream 350835 5774249 ~ 5775541 (-)
CI01000299_05896205_05898855 NA non-coding upstream 398161 5896043 ~ 5898857 (-)
G407413 NA other downstream 868682 4475994 ~ 4550721 (-)
G405053 NA other downstream 3401353 2017687 ~ 2018050 (-)
G404976 NA other downstream 3538415 1855639 ~ 1880988 (-)
G407805 NA other upstream 404422 5835889 ~ 5835989 (-)
CI01000299_06526127_06532048 CEP97 other upstream 1108587 6526127 ~ 6532048 (-)

Expression


Co-expression Network