AMCG00014409 (rpl24)


Basic Information

Item Value
gene id AMCG00014409
gene name rpl24
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 13262379 ~ 13265549 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014409
GCAGTTTGAAGAATGATTAAGCATCATACCTTCTATTTGTGCCATCTTTGCATCTGCTCCCCCCACTTTAGCCGCCATACTTCCCGCTTGTGTTGACGCCAGGCAACCGATCAAACTCCTGGGACTACCCACAATTCCCTCTGTCTTTTCTCCATCTTAGCCGCCGTCATGAAGGTCGAGTTGTGCAGTTTTAGCGGATACAAAATCTACCCCGGCCATGGCCGGCGTTACGCCAGGATAGACGGAAAGGTTTTCCAGTTCCTGAATGCAAAGTGTGAGTCTGCATTCCTGTCCAAGAGGAATCCTCGCCAGATCAACTGGACCGTCCTGTACAGACGCAAGCACAAGAAGGGCCAGTCTGAAGAAGTGACGAAGAAGCGTACTCGCCGTGCGGTGAAGTTCCAGAGGGCCATCACTGGCGCCTCTCTGGCCGAGATCTTGGCCAAGAGGAACCAGAAGCCCGAGGTGCGCAAGGCTCAGCGGGAACAGGCCATCAGGGCTGCTAAAGAAGCCAAGAAGGCCAAGCAGGCAACCAAAAAGGTAGCTGCCCCAAGTACTAAGGCCCCTACCAAGACTGCACCTAAGCAGAAGATCGCCAAGCCCATGAAGGTCCAGGCACCACGTGTTGGCGGAAAACGCTAAAAAATTATGACTTGGTGATTAGTTGTTAATAAACTTTTGACTGTAAGAAA

Function

symbol description
rpl24 Predicted to enable mRNA binding activity. Predicted to be a structural constituent of ribosome. Acts upstream of or within chordate embryonic development. Predicted to be located in ribosome. Predicted to be part of cytosolic large ribosomal subunit. Is expressed in endodermal cell; intestine; liver; and pancreas. Orthologous to human RPL24 (ribosomal protein L24).

NR:

description
PREDICTED: 60S ribosomal protein L24

GO:

id name namespace
GO:0009790 embryo development biological_process
GO:0005840 ribosome cellular_component

KEGG:

id description
K02896 RP-L24e, RPL24; large subunit ribosomal protein L24e

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014409 True 692 mRNA 0.52 7 13262379 13265549

Neighbor

gene id symbol gene type direction distance location
AMCG00014410 NA coding downstream 1390 13251935 ~ 13260989 (-)
AMCG00014413 txnl4b coding downstream 19727 13241826 ~ 13242652 (-)
AMCG00014408 NA coding downstream 24851 13208745 ~ 13237528 (-)
AMCG00014411 impg2b,LOC108432621,LOC107704545 coding downstream 58572 13175211 ~ 13203807 (-)
AMCG00014398 NA coding downstream 279884 12907404 ~ 12982495 (-)
AMCG00014437 me3,LOC108426042,LOC107748144,LOC107595810,LOC107756775,LOC107695468 coding upstream 112113 13377662 ~ 13408576 (-)
AMCG00014434 LOC106575972 coding upstream 177721 13443270 ~ 13473171 (-)
AMCG00014432 NA coding upstream 212799 13478348 ~ 13487613 (-)
AMCG00014438 NA coding upstream 233177 13498726 ~ 13527602 (-)
AMCG00014430 NA coding upstream 265646 13531195 ~ 13536369 (-)
G69896 NA non-coding downstream 176034 13085363 ~ 13086345 (-)
G69849 NA non-coding downstream 291824 12970253 ~ 12970555 (-)
G69759 NA non-coding downstream 1381923 11879097 ~ 11880456 (-)
G69743 NA non-coding downstream 1490986 11769690 ~ 11771393 (-)
G69539 NA non-coding downstream 2441307 10815771 ~ 10821072 (-)
G69950 NA non-coding upstream 36375 13301924 ~ 13302379 (-)
G69973 NA non-coding upstream 38877 13304426 ~ 13375879 (-)
G70034 NA non-coding upstream 357566 13623115 ~ 13623381 (-)
G70063 NA non-coding upstream 429208 13694757 ~ 13696971 (-)
G70091 NA non-coding upstream 493677 13759226 ~ 13761420 (-)
AMCG00014412 LOC106574775,LOC107704546 other downstream 128628 13087608 ~ 13133751 (-)
AMCG00014374 NA other downstream 1594842 11660011 ~ 11667537 (-)
AMCG00014365 ube2al,ube2a,LOC105016494,LOC107552373,LOC103021436,LOC103029486,LOC108259060,LOC105934920 other downstream 2125293 11125029 ~ 11137086 (-)
G69537 NA other downstream 2464232 10796716 ~ 10798147 (-)
AMCG00014339 dph3,LOC105022091,LOC106574460 other downstream 3201149 10058097 ~ 10061230 (-)
AMCG00014539 wdr3,LOC107569352,LOC107658238,LOC107712260,LOC107724477,LOC107668854 other upstream 3456524 16722073 ~ 16737877 (-)
AMCG00014555 LOC103136798,LOC106917865,LOC103473267,LOC106919874,LOC103148706,LOC108242195,LOC100692262,LOC101156309 other upstream 4181319 17446868 ~ 17462290 (-)
AMCG00014559 NA other upstream 4323718 17589267 ~ 17621151 (-)
AMCG00014567 mzt1,si:dkey-15d12.2 other upstream 4725102 17990651 ~ 18022095 (-)
AMCG00014604 kctd4,LOC107688678,LOC107748885 other upstream 5936254 19201803 ~ 19203567 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location