RNA id: TCONS_00036041



Basic Information


Item Value
RNA id TCONS_00036041
length 395
RNA type mRNA
GC content 0.47
exon number 5
gene id XLOC_018304
representative True

Chromosome Information


Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 39691793 ~ 39735987 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GTGCAGAGTGTGTCTAGTGGAGCTTTATTTTCACAGTACCGCTAATATGGAGCCCAGACAACAGGAGCTGTACTCTAGCGTACTGACTCCTGAAGCAGTAGACTGGGAGGACAGAGAAACCTTCCAGGCAGGTTTATTAGACAAGGAGTCTCTAAAGGAAGCGGATGAGGACATGGTGTCAGAAGTGGACCTTAACAACACATACACAGAAGAGGAGCGAGAGGAAATGGAGAATGAGTTGACTAAGTTAGAAGAAGAAATCACTACTTTGAAACAAGTCCTGGCCTCCAAAGAGAAGCGTCACTTGGAGTTGAAACAGAAACTGGGGATCACGGCTCTGAGTGAACTGCGGCACAACTTCAACAAGAGCTGGAATGACATGCAGACCAGCACAG

Function


GO: NA

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-121 Predicted to be involved in positive regulation of MAP kinase activity and positive regulation of apoptotic signaling pathway. Predicted to be active in cytoplasm. Orthologous to human TPD52L1 (TPD52 like 1).

Ensembl:

ensembl_id ENSDART00000137485

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00036038 lncRNA downstream 26984 39677521 ~ 39686127 (-) True XLOC_018303
TCONS_00036036 lncRNA downstream 27042 39601856 ~ 39686069 (-) False XLOC_018303
TCONS_00036035 lncRNA downstream 27077 39601856 ~ 39686034 (-) False XLOC_018303
TCONS_00036037 lncRNA downstream 27077 39620350 ~ 39686034 (-) False XLOC_018303
TCONS_00036939 lncRNA downstream 210144 39493111 ~ 39502967 (-) True XLOC_018296
TCONS_00036940 lncRNA upstream 8234 39744195 ~ 39746437 (-) True XLOC_018305
TCONS_00036941 lncRNA upstream 83066 39819027 ~ 39832119 (-) False XLOC_018307
TCONS_00036942 lncRNA upstream 157113 39893074 ~ 40019218 (-) False XLOC_018307
TCONS_00036047 lncRNA upstream 183271 39919232 ~ 39920174 (-) True XLOC_018308
TCONS_00036943 lncRNA upstream 479408 40215369 ~ 40254480 (-) False XLOC_018309
TCONS_00036034 mRNA downstream 116773 39588897 ~ 39596338 (-) True XLOC_018302
TCONS_00036033 mRNA downstream 130795 39576311 ~ 39582316 (-) True XLOC_018301
TCONS_00036032 mRNA downstream 130825 39520628 ~ 39582286 (-) False XLOC_018301
TCONS_00036031 mRNA downstream 195947 39513435 ~ 39517164 (-) True XLOC_018300
TCONS_00036025 mRNA downstream 321619 39389818 ~ 39391492 (-) True XLOC_018297
TCONS_00036042 mRNA upstream 13487 39749448 ~ 39789036 (-) False XLOC_018306
TCONS_00036043 mRNA upstream 16422 39752383 ~ 39789039 (-) False XLOC_018306
TCONS_00036044 mRNA upstream 19518 39755479 ~ 39789846 (-) True XLOC_018306
TCONS_00036045 mRNA upstream 70409 39806370 ~ 40119872 (-) False XLOC_018307
TCONS_00036046 mRNA upstream 157113 39893074 ~ 40119090 (-) True XLOC_018307
TCONS_00036008 other downstream 680175 39032821 ~ 39032936 (-) True XLOC_018289
TCONS_00036007 other downstream 807498 38905531 ~ 38905613 (-) True XLOC_018288
TCONS_00035989 other downstream 1190462 38518697 ~ 38522649 (-) False XLOC_018280
TCONS_00035984 other downstream 1778796 37930687 ~ 37934315 (-) True XLOC_018273
TCONS_00035936 other downstream 4167917 35541282 ~ 35545194 (-) True XLOC_018246
TCONS_00036068 other upstream 1026351 40762312 ~ 40766351 (-) False XLOC_018321
TCONS_00036069 other upstream 1026371 40762332 ~ 40766350 (-) False XLOC_018321
TCONS_00036070 other upstream 1026390 40762351 ~ 40766618 (-) True XLOC_018321
TCONS_00036071 other upstream 1492103 41228064 ~ 41228179 (-) True XLOC_018322
TCONS_00036072 other upstream 1616885 41352846 ~ 41352960 (-) True XLOC_018324

Expression Profile


//