RNA id: TCONS_00036046



Basic Information


Item Value
RNA id TCONS_00036046
length 474
RNA type mRNA
GC content 0.54
exon number 4
gene id XLOC_018307
representative True

Chromosome Information


Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 39806370 ~ 40119872 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


ATGGGCTGCTGCAGTGGCAGATGTACGCTGGCGTTTATATGTGGCATGCAATTGATCAGCATCCTGGAGCGACAGATATTTGATTTCCTCGGATACCAGTGGGCTCCGATCCTTACAAACTTCATCCACATCATCACAGTGATTCTAGGCCTTTTTGGGACGGTACAGTTCAGACCGCGATATGTGACCGGGTATGCAGTCTGGTTGGTGCTGTGGGTCGCCTGGAACGTCTTCATCATCTGTTTCTATTTGGAAGTGGGTGACCTTTCAAAGGACACAGACCTGATTATGACCTTTAACATCTCCATGCATCGCTCCTGGTGGATGGAGAACGGCCCCGGGTGCAGGGTGACCCCGGTGACCCCTCCTCCATCCTGGGCCCCGGAGGACCATCGCTACATCAGCATCGCCGGCTGCCTGCTGGAGTACCAGTTTGTGGAGGTGGCCCACAGTTCCTTGCAGATTATCCTGGCT

Function


GO:

id name namespace
GO:0002028 regulation of sodium ion transport biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-041014-77 Predicted to be involved in regulation of sodium ion transport. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Orthologous to human NKAIN2 (sodium/potassium transporting ATPase interacting 2).

Ensembl:

ensembl_id ENSDART00000145592

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00036941 lncRNA downstream 60955 39819027 ~ 39832119 (-) False XLOC_018307
TCONS_00036940 lncRNA downstream 146637 39744195 ~ 39746437 (-) True XLOC_018305
TCONS_00036038 lncRNA downstream 206947 39677521 ~ 39686127 (-) True XLOC_018303
TCONS_00036036 lncRNA downstream 207005 39601856 ~ 39686069 (-) False XLOC_018303
TCONS_00036035 lncRNA downstream 207040 39601856 ~ 39686034 (-) False XLOC_018303
TCONS_00036943 lncRNA upstream 96279 40215369 ~ 40254480 (-) False XLOC_018309
TCONS_00036944 lncRNA upstream 96279 40215369 ~ 40254485 (-) True XLOC_018309
TCONS_00036491 lncRNA upstream 211016 40330106 ~ 40336899 (-) True XLOC_018311
TCONS_00036055 lncRNA upstream 360839 40479929 ~ 40484965 (-) True XLOC_018315
TCONS_00036066 lncRNA upstream 638308 40757398 ~ 40758384 (-) True XLOC_018320
TCONS_00036044 mRNA downstream 103228 39755479 ~ 39789846 (-) True XLOC_018306
TCONS_00036043 mRNA downstream 104035 39752383 ~ 39789039 (-) False XLOC_018306
TCONS_00036042 mRNA downstream 104038 39749448 ~ 39789036 (-) False XLOC_018306
TCONS_00036041 mRNA downstream 157113 39713111 ~ 39735961 (-) True XLOC_018304
TCONS_00036040 mRNA downstream 157122 39700010 ~ 39735952 (-) False XLOC_018304
TCONS_00036048 mRNA upstream 150801 40269891 ~ 40319890 (-) True XLOC_018310
TCONS_00036049 mRNA upstream 218333 40337423 ~ 40360571 (-) False XLOC_018312
TCONS_00036050 mRNA upstream 218333 40337423 ~ 40367493 (-) True XLOC_018312
TCONS_00036051 mRNA upstream 250167 40369257 ~ 40370736 (-) True XLOC_018313
TCONS_00036052 mRNA upstream 252807 40371897 ~ 40451115 (-) True XLOC_018314
TCONS_00036008 other downstream 860138 39032821 ~ 39032936 (-) True XLOC_018289
TCONS_00036007 other downstream 987461 38905531 ~ 38905613 (-) True XLOC_018288
TCONS_00035989 other downstream 1370425 38518697 ~ 38522649 (-) False XLOC_018280
TCONS_00035984 other downstream 1958759 37930687 ~ 37934315 (-) True XLOC_018273
TCONS_00035936 other downstream 4347880 35541282 ~ 35545194 (-) True XLOC_018246
TCONS_00036068 other upstream 643222 40762312 ~ 40766351 (-) False XLOC_018321
TCONS_00036069 other upstream 643242 40762332 ~ 40766350 (-) False XLOC_018321
TCONS_00036070 other upstream 643261 40762351 ~ 40766618 (-) True XLOC_018321
TCONS_00036071 other upstream 1108974 41228064 ~ 41228179 (-) True XLOC_018322
TCONS_00036072 other upstream 1233756 41352846 ~ 41352960 (-) True XLOC_018324

Expression Profile


//