RNA id: TCONS_00051940



Basic Information


Item Value
RNA id TCONS_00051940
length 842
lncRNA type retained_intron
GC content 0.54
exon number 3
gene id XLOC_026667
representative False

Chromosome Information


Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 40526107 ~ 40529804 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


TTGAGCTCCTCCACACGCAGCTAGTGCGGAATATCATCTGCTTGTAACCCATTCTCTTAAGTCGACAACCCCCCAAACCCAAGTTCAGCCATGGATGATGAAATTGCCGCACTGGTTGTTGACAACGGATCCGGTATGTGCAAAGCCGGATTCGCTGGAGATGATGCTCCCCGTGCTGTCTTCCCATCCATCGTGGGTCGCCCCAGACATCAGGTGAGAAGACCGATTAGTTTGATTCTGACCCAAACTGAGAACTTTCTCAAGTAGTTCACAAAATGTAACGCTTGTGTCCTTGCATTACAGGGTGTCATGGTTGGTATGGGACAGAAAGACAGCTACGTTGGTGATGAGGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCCATCGAGCACGGTATTGTCACCAACTGGGATGATATGGAGAAGATCTGGCATCACACCTTCTACAACGAGCTGCGTGTTGCCCCAGAGGAGCACCCCGTCCTGCTCACAGAGGCCCCCCTGAACCCCAAGGCCAACAGGGAAAAGATGACACAGATCATGTTCGAGACCTTCAACACCCCCGCCATGTACGTTGCCATCCAGGCTGTGCTGTCCCTGTATGCCTCCGGTCGTACCACTGGTATCGTGATGGACTCTGGTGATGGTGTCACCCACACTGTGCCCATCTACGAGGGTTACGCCCTGCCCCATGCCATCCTCCGTCTGGACTTGGCTGGCCGTGACCTGACTGACTACCTCATGAAGATCCTGACCGAGAGAGGCTACAGCTTCACCACCACAGCTGAGAGGGAAATTGTCCGTGACATCAAGGAGAAGCTCTGCTATGTGGCCCT

Function


GO:

id name namespace
GO:0005856 cytoskeleton cellular_component
GO:0005884 actin filament cellular_component
GO:0005886 plasma membrane cellular_component
GO:0097433 dense body cellular_component
GO:0005925 focal adhesion cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005524 ATP binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0098973 structural constituent of postsynaptic actin cytoskeleton molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-000329-3 Predicted to be a structural constituent of postsynaptic actin cytoskeleton. Predicted to be located in several cellular components, including cytoskeleton; dense body; and focal adhesion. Predicted to be active in actin filament. Is expressed in several structures, including blastomere; brain; eye; musculature system; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in Baraitser-Winter syndrome and autosomal dominant nonsyndromic deafness 20. Orthologous to several human genes including ACTB (actin beta).

Ensembl:

ensembl_id ENSDART00000132497

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00051934 lncRNA downstream 121899 40396063 ~ 40405386 (-) False XLOC_026666
TCONS_00053082 lncRNA downstream 122036 40396063 ~ 40405249 (-) False XLOC_026666
TCONS_00053083 lncRNA downstream 122251 40403056 ~ 40405034 (-) True XLOC_026666
TCONS_00051928 lncRNA downstream 275340 40251416 ~ 40251945 (-) True XLOC_026662
TCONS_00053081 lncRNA downstream 345631 40180136 ~ 40181654 (-) True XLOC_026659
TCONS_00053084 lncRNA upstream 244643 40774418 ~ 40777723 (-) True XLOC_026671
TCONS_00051957 lncRNA upstream 429803 40959578 ~ 40962832 (-) True XLOC_026677
TCONS_00051965 lncRNA upstream 866348 41396123 ~ 41512210 (-) False XLOC_026681
TCONS_00051966 lncRNA upstream 915419 41445194 ~ 41512210 (-) True XLOC_026681
TCONS_00051968 lncRNA upstream 1001507 41531282 ~ 41535761 (-) True XLOC_026682
TCONS_00051933 mRNA downstream 225818 40296785 ~ 40301467 (-) True XLOC_026665
TCONS_00051932 mRNA downstream 242541 40277704 ~ 40284744 (-) True XLOC_026664
TCONS_00051929 mRNA downstream 251214 40260929 ~ 40276071 (-) False XLOC_026663
TCONS_00051943 mRNA upstream 70995 40600770 ~ 40664913 (-) False XLOC_026668
TCONS_00051944 mRNA upstream 75344 40605119 ~ 40664868 (-) False XLOC_026668
TCONS_00051945 mRNA upstream 75613 40605388 ~ 40658820 (-) True XLOC_026668
TCONS_00051946 mRNA upstream 150156 40679931 ~ 40681001 (-) True XLOC_026669
TCONS_00051947 mRNA upstream 160437 40690212 ~ 40768548 (-) True XLOC_026670
TCONS_00051924 other downstream 368598 40154294 ~ 40158687 (-) True XLOC_026658
TCONS_00051921 other downstream 438484 40088685 ~ 40088801 (-) True XLOC_026657
TCONS_00051914 other downstream 569811 39957358 ~ 39957474 (-) True XLOC_026654
TCONS_00051909 other downstream 877723 39649445 ~ 39649562 (-) True XLOC_026651
TCONS_00051900 other downstream 1267608 39238096 ~ 39259677 (-) False XLOC_026643
TCONS_00051964 other upstream 782247 41312022 ~ 41312143 (-) True XLOC_026680
TCONS_00051981 other upstream 2336308 42866083 ~ 42866200 (-) True XLOC_026691
TCONS_00052007 other upstream 3551848 44081623 ~ 44094226 (-) False XLOC_026707
TCONS_00052055 other upstream 6665362 47195137 ~ 47195234 (-) True XLOC_026732
TCONS_00052070 other upstream 8547987 49077762 ~ 49077879 (-) True XLOC_026748

Expression Profile


//