RNA id: TCONS_00052055


Basic Information

Item Value
RNA id TCONS_00052055
length 98
RNA type miRNA
GC content 0.58
exon number 1
gene id XLOC_026732
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 47194738 ~ 47196960 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCTCCCCCTCGCCTGCCCAGTGTTCAGACTACCTGTTCATCATGCTGCAGCTGAACAGTAGTCCGCACATTGGTTAGGCTGGGCTGGGACACACACAC

Function

GO:

id name namespace
GO:0042692 muscle cell differentiation biological_process
GO:0048468 cell development biological_process
GO:0048747 muscle fiber development biological_process
GO:0051146 striated muscle cell differentiation biological_process
GO:0007517 muscle organ development biological_process
GO:0007519 skeletal muscle tissue development biological_process
GO:0006936 muscle contraction biological_process
GO:0010927 cellular component assembly involved in morphogenesis biological_process
GO:0055001 muscle cell development biological_process
GO:0055002 striated muscle cell development biological_process
GO:1903169 regulation of calcium ion transmembrane transport biological_process
GO:0014866 skeletal myofibril assembly biological_process
GO:0010959 regulation of metal ion transport biological_process
GO:0031032 actomyosin structure organization biological_process
GO:0031033 myosin filament organization biological_process
GO:0031034 myosin filament assembly biological_process
GO:0097435 supramolecular fiber organization biological_process
GO:0030239 myofibril assembly biological_process
GO:0032989 cellular component morphogenesis biological_process
GO:0071688 striated muscle myosin thick filament assembly biological_process
GO:0071691 cardiac muscle thin filament assembly biological_process
GO:0003012 muscle system process biological_process
GO:0061061 muscle structure development biological_process
GO:0060537 muscle tissue development biological_process
GO:0060538 skeletal muscle organ development biological_process
GO:0051924 regulation of calcium ion transport biological_process
GO:0014706 striated muscle tissue development biological_process
GO:0042383 sarcolemma cellular_component
GO:0034704 calcium channel complex cellular_component
GO:0099080 supramolecular complex cellular_component
GO:0099081 supramolecular polymer cellular_component
GO:0043292 contractile fiber cellular_component
GO:0044449 obsolete contractile fiber part cellular_component
GO:0016528 sarcoplasm cellular_component
GO:0015629 actin cytoskeleton cellular_component
GO:0099512 supramolecular fiber cellular_component
GO:0031672 A band cellular_component
GO:0031674 I band cellular_component
GO:0030016 myofibril cellular_component
GO:0030017 sarcomere cellular_component
GO:0030018 Z disc cellular_component
GO:0031430 M band cellular_component
GO:0051015 actin filament binding molecular_function
GO:0003779 actin binding molecular_function
GO:0044877 protein-containing complex binding molecular_function
GO:0008092 cytoskeletal protein binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000116683

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00053104 lncRNA downstream 64026 47130032 ~ 47131111 (-) True XLOC_026731
TCONS_00052045 lncRNA downstream 377281 46811351 ~ 46817856 (-) True XLOC_026728
TCONS_00052040 lncRNA downstream 432431 46757611 ~ 46762706 (-) True XLOC_026727
TCONS_00053103 lncRNA downstream 731881 46462585 ~ 46463256 (-) True XLOC_026726
TCONS_00052034 lncRNA downstream 968127 46224721 ~ 46227010 (-) False XLOC_026723
TCONS_00053105 lncRNA upstream 631968 47827202 ~ 47833114 (-) True XLOC_026736
TCONS_00053106 lncRNA upstream 1128306 48323540 ~ 48328133 (-) True XLOC_026738
TCONS_00053108 lncRNA upstream 1266263 48461497 ~ 48469102 (-) False XLOC_026739
TCONS_00053107 lncRNA upstream 1266263 48461497 ~ 48469102 (-) False XLOC_026739
TCONS_00053110 lncRNA upstream 1266263 48461497 ~ 48469108 (-) False XLOC_026739
TCONS_00052054 mRNA downstream 67041 47114328 ~ 47128096 (-) True XLOC_026730
TCONS_00052049 mRNA downstream 89870 46919522 ~ 47105267 (-) False XLOC_026729
TCONS_00052048 mRNA downstream 89870 46919522 ~ 47105267 (-) False XLOC_026729
TCONS_00052047 mRNA downstream 89870 46919522 ~ 47105267 (-) False XLOC_026729
TCONS_00052051 mRNA downstream 89870 46920637 ~ 47105267 (-) False XLOC_026729
TCONS_00052056 mRNA upstream 26862 47222096 ~ 47235997 (-) True XLOC_026733
TCONS_00052057 mRNA upstream 86002 47281236 ~ 47294365 (-) True XLOC_026734
TCONS_00052059 mRNA upstream 303199 47498433 ~ 47876427 (-) False XLOC_026735
TCONS_00052058 mRNA upstream 303199 47498433 ~ 47876427 (-) True XLOC_026735
TCONS_00052060 mRNA upstream 1057968 48253202 ~ 48259289 (-) True XLOC_026737
TCONS_00052007 other downstream 3100911 44081623 ~ 44094226 (-) False XLOC_026707
TCONS_00051981 other downstream 4328937 42866083 ~ 42866200 (-) True XLOC_026691
TCONS_00051964 other downstream 5882994 41312022 ~ 41312143 (-) True XLOC_026680
TCONS_00051939 other downstream 6665358 40526882 ~ 40529779 (-) False XLOC_026667
TCONS_00051938 other downstream 6665359 40526879 ~ 40529778 (-) False XLOC_026667
TCONS_00052070 other upstream 1882528 49077762 ~ 49077879 (-) True XLOC_026748
TCONS_00052082 other upstream 2619963 49815197 ~ 49815287 (-) False XLOC_026760
TCONS_00052087 other upstream 2908837 50104071 ~ 50117962 (-) True XLOC_026764
TCONS_00052109 other upstream 4352899 51548133 ~ 51548250 (-) True XLOC_026779
TCONS_00052111 other upstream 4712252 51907486 ~ 51907562 (-) True XLOC_026783