RNA id: TCONS_00053390


Basic Information

Item Value
RNA id TCONS_00053390
length 101
RNA type processed_transcript
GC content 0.51
exon number 1
gene id XLOC_027085
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 7415280 ~ 7506470 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGATTTGGGAGTGAAGGAGCAGCTCTACTCCTTTTTCTGTTTGCAGGCAGCTTTTCTTCGCACATCTAAAGGACGCGCACTTCGTTCGCCTCATCGCGCAG

Function

GO:

id name namespace
GO:0009259 ribonucleotide metabolic process biological_process
GO:0048468 cell development biological_process
GO:0009260 ribonucleotide biosynthetic process biological_process
GO:1902600 proton transmembrane transport biological_process
GO:0006928 movement of cell or subcellular component biological_process
GO:0046034 ATP metabolic process biological_process
GO:0006935 chemotaxis biological_process
GO:0000902 cell morphogenesis biological_process
GO:0006091 generation of precursor metabolites and energy biological_process
GO:0000904 cell morphogenesis involved in differentiation biological_process
GO:1901293 nucleoside phosphate biosynthetic process biological_process
GO:0009060 aerobic respiration biological_process
GO:1990138 neuron projection extension biological_process
GO:0048812 neuron projection morphogenesis biological_process
GO:0006119 oxidative phosphorylation biological_process
GO:0043062 extracellular structure organization biological_process
GO:0030198 extracellular matrix organization biological_process
GO:0120036 plasma membrane bounded cell projection organization biological_process
GO:0120039 plasma membrane bounded cell projection morphogenesis biological_process
GO:0022900 electron transport chain biological_process
GO:0098662 inorganic cation transmembrane transport biological_process
GO:0006163 purine nucleotide metabolic process biological_process
GO:0006164 purine nucleotide biosynthetic process biological_process
GO:0017144 drug metabolic process biological_process
GO:0048858 cell projection morphogenesis biological_process
GO:0048588 developmental cell growth biological_process
GO:0009117 nucleotide metabolic process biological_process
GO:0009123 nucleoside monophosphate metabolic process biological_process
GO:0009124 nucleoside monophosphate biosynthetic process biological_process
GO:0009126 purine nucleoside monophosphate metabolic process biological_process
GO:0009127 purine nucleoside monophosphate biosynthetic process biological_process
GO:0032989 cellular component morphogenesis biological_process
GO:0032990 cell part morphogenesis biological_process
GO:0046390 ribose phosphate biosynthetic process biological_process
GO:0055086 nucleobase-containing small molecule metabolic process biological_process
GO:0019637 organophosphate metabolic process biological_process
GO:0006753 nucleoside phosphate metabolic process biological_process
GO:0006754 ATP biosynthetic process biological_process
GO:0009141 nucleoside triphosphate metabolic process biological_process
GO:0009142 nucleoside triphosphate biosynthetic process biological_process
GO:0009144 purine nucleoside triphosphate metabolic process biological_process
GO:0009145 purine nucleoside triphosphate biosynthetic process biological_process
GO:0009150 purine ribonucleotide metabolic process biological_process
GO:0015672 monovalent inorganic cation transport biological_process
GO:0044281 small molecule metabolic process biological_process
GO:0009152 purine ribonucleotide biosynthetic process biological_process
GO:0090407 organophosphate biosynthetic process biological_process
GO:1901135 carbohydrate derivative metabolic process biological_process
GO:1901137 carbohydrate derivative biosynthetic process biological_process
GO:0009156 ribonucleoside monophosphate biosynthetic process biological_process
GO:0040011 locomotion biological_process
GO:0072521 purine-containing compound metabolic process biological_process
GO:0072522 purine-containing compound biosynthetic process biological_process
GO:0009161 ribonucleoside monophosphate metabolic process biological_process
GO:0009165 nucleotide biosynthetic process biological_process
GO:0097485 neuron projection guidance biological_process
GO:0009167 purine ribonucleoside monophosphate metabolic process biological_process
GO:0071711 basement membrane organization biological_process
GO:0009168 purine ribonucleoside monophosphate biosynthetic process biological_process
GO:0061564 axon development biological_process
GO:0048666 neuron development biological_process
GO:0048667 cell morphogenesis involved in neuron differentiation biological_process
GO:0015985 energy coupled proton transport, down electrochemical gradient biological_process
GO:0019693 ribose phosphate metabolic process biological_process
GO:0015986 ATP synthesis coupled proton transport biological_process
GO:0048675 axon extension biological_process
GO:0007409 axonogenesis biological_process
GO:0007411 axon guidance biological_process
GO:0009199 ribonucleoside triphosphate metabolic process biological_process
GO:0042330 taxis biological_process
GO:0009201 ribonucleoside triphosphate biosynthetic process biological_process
GO:0009205 purine ribonucleoside triphosphate metabolic process biological_process
GO:0009206 purine ribonucleoside triphosphate biosynthetic process biological_process
GO:0060560 developmental growth involved in morphogenesis biological_process
GO:0031175 neuron projection development biological_process
GO:0045333 cellular respiration biological_process
GO:0016049 cell growth biological_process
GO:0098803 respiratory chain complex cellular_component
GO:0005743 mitochondrial inner membrane cellular_component
GO:0005746 mitochondrial respirasome cellular_component
GO:0005747 mitochondrial respiratory chain complex I cellular_component
GO:0005753 mitochondrial proton-transporting ATP synthase complex cellular_component
GO:0030964 NADH dehydrogenase complex cellular_component
GO:0044420 obsolete extracellular matrix component cellular_component
GO:0044429 obsolete mitochondrial part cellular_component
GO:0016469 proton-transporting two-sector ATPase complex cellular_component
GO:0044455 obsolete mitochondrial membrane part cellular_component
GO:0033177 proton-transporting two-sector ATPase complex, proton-transporting domain cellular_component
GO:0031012 extracellular matrix cellular_component
GO:0062023 collagen-containing extracellular matrix cellular_component
GO:0019866 organelle inner membrane cellular_component
GO:0098644 complex of collagen trimers cellular_component
GO:0005581 collagen trimer cellular_component
GO:0005588 collagen type V trimer cellular_component
GO:0005604 basement membrane cellular_component
GO:0032991 protein-containing complex cellular_component
GO:1990204 oxidoreductase complex cellular_component
GO:0031090 organelle membrane cellular_component
GO:0045259 proton-transporting ATP synthase complex cellular_component
GO:0045261 proton-transporting ATP synthase complex, catalytic core F(1) cellular_component
GO:0045263 proton-transporting ATP synthase complex, coupling factor F(o) cellular_component
GO:0045271 respiratory chain complex I cellular_component
GO:0045277 respiratory chain complex IV cellular_component
GO:0031966 mitochondrial membrane cellular_component
GO:0031967 organelle envelope cellular_component
GO:0031975 envelope cellular_component
GO:0000275 mitochondrial proton-transporting ATP synthase complex, catalytic sector F(1) cellular_component
GO:0000276 mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) cellular_component
GO:0070469 respirasome cellular_component
GO:0098796 membrane protein complex cellular_component
GO:0098798 mitochondrial protein-containing complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005739 mitochondrion cellular_component
GO:0098800 inner mitochondrial membrane protein complex cellular_component
GO:0005740 mitochondrial envelope cellular_component
GO:0008137 NADH dehydrogenase (ubiquinone) activity molecular_function
GO:0019829 ATPase-coupled cation transmembrane transporter activity molecular_function
GO:0009055 electron transfer activity molecular_function
GO:0022853 active ion transmembrane transporter activity molecular_function
GO:0003954 NADH dehydrogenase activity molecular_function
GO:0022857 transmembrane transporter activity molecular_function
GO:0050136 NADH dehydrogenase (quinone) activity molecular_function
GO:0044769 ATPase activity, coupled to transmembrane movement of ions, rotational mechanism molecular_function
GO:0022890 inorganic cation transmembrane transporter activity molecular_function
GO:0015002 heme-copper terminal oxidase activity molecular_function
GO:0046933 proton-transporting ATP synthase activity, rotational mechanism molecular_function
GO:0005201 extracellular matrix structural constituent molecular_function
GO:0015318 inorganic molecular entity transmembrane transporter activity molecular_function
GO:0015075 ion transmembrane transporter activity molecular_function
GO:0015077 monovalent inorganic cation transmembrane transporter activity molecular_function
GO:0015078 proton transmembrane transporter activity molecular_function
GO:0042625 ATPase-coupled ion transmembrane transporter activity molecular_function
GO:0008324 cation transmembrane transporter activity molecular_function
GO:0016655 oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor molecular_function
GO:0004129 cytochrome-c oxidase activity molecular_function
GO:0016675 oxidoreductase activity, acting on a heme group of donors molecular_function
GO:0016676 oxidoreductase activity, acting on a heme group of donors, oxygen as acceptor molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

ZFIN:

id description
ZDB-GENE-030131-1629 Predicted to enable actin binding activity and myosin binding activity. Acts upstream of or within peristalsis. Predicted to be active in actin cytoskeleton. Is expressed in intestinal epithelium and intestine. Orthologous to human CALD1 (caldesmon 1).

Ensembl:

ensembl_id ENSDART00000168327

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00053387 lncRNA upstream 9078 7391354 ~ 7406259 (+) False XLOC_027084
TCONS_00053389 lncRNA upstream 12572 7391490 ~ 7402765 (+) True XLOC_027084
TCONS_00053388 lncRNA upstream 18312 7391462 ~ 7397025 (+) False XLOC_027084
TCONS_00057598 lncRNA upstream 303315 7111729 ~ 7112022 (+) True XLOC_027082
TCONS_00057597 lncRNA upstream 395315 7005809 ~ 7020022 (+) True XLOC_027080
TCONS_00057599 lncRNA downstream 130223 7545660 ~ 7554621 (+) False XLOC_027087
TCONS_00057600 lncRNA downstream 130223 7545660 ~ 7583552 (+) False XLOC_027087
TCONS_00057601 lncRNA downstream 130270 7545707 ~ 7587145 (+) False XLOC_027087
TCONS_00057602 lncRNA downstream 130346 7545783 ~ 7549822 (+) False XLOC_027087
TCONS_00057603 lncRNA downstream 130350 7545787 ~ 7583552 (+) False XLOC_027087
TCONS_00053385 mRNA upstream 6024 7391215 ~ 7409313 (+) False XLOC_027084
TCONS_00053384 mRNA upstream 9084 7391110 ~ 7406253 (+) False XLOC_027084
TCONS_00053386 mRNA upstream 9791 7391400 ~ 7405546 (+) False XLOC_027084
TCONS_00053375 mRNA upstream 421054 6833583 ~ 6994283 (+) False XLOC_027077
TCONS_00053392 mRNA downstream 92879 7508316 ~ 7538138 (+) False XLOC_027086
TCONS_00053393 mRNA downstream 92880 7508317 ~ 7543967 (+) False XLOC_027086
TCONS_00053394 mRNA downstream 92886 7508323 ~ 7544571 (+) False XLOC_027086
TCONS_00053395 mRNA downstream 92895 7508332 ~ 7544371 (+) False XLOC_027086
TCONS_00053396 mRNA downstream 92900 7508337 ~ 7544687 (+) False XLOC_027086
TCONS_00053383 other upstream 251463 7163758 ~ 7163874 (+) True XLOC_027083
TCONS_00053382 other upstream 390054 7025167 ~ 7025283 (+) True XLOC_027081
TCONS_00053381 other upstream 500486 6914716 ~ 6914851 (+) True XLOC_027079
TCONS_00053350 other upstream 1630466 5778229 ~ 5784871 (+) True XLOC_027061
TCONS_00053336 other upstream 1899475 5506952 ~ 5515862 (+) False XLOC_027055
TCONS_00053415 other downstream 719157 8134594 ~ 8134710 (+) True XLOC_027099
TCONS_00053421 other downstream 1088250 8503687 ~ 8503801 (+) True XLOC_027102
TCONS_00053451 other downstream 2177094 9592531 ~ 9598700 (+) True XLOC_027123
TCONS_00053480 other downstream 3291318 10706755 ~ 10713584 (+) False XLOC_027140
TCONS_00053484 other downstream 3337303 10752740 ~ 10763285 (+) False XLOC_027142