RNA id: TCONS_00005558


Basic Information

Item Value
RNA id TCONS_00005558
length 510
RNA type mRNA
GC content 0.56
exon number 3
gene id XLOC_003033
representative False

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 41318583 ~ 41352608 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGTCTCTGGCAGAGCAAAGCCAGCAGTGGATTCCCACCAGCGTGCAGGTAACGGTGCTGCAGGCGCGCGGTTTGCGCTGTAAGGGCAAAAATGGCACGAACGACGCGTACGCCATCATGCAGGTGGCCAAGGAGAAGTTCTCCACCTCGGTGGCCGAAAAAAGCGTGGCTCCGGTGTGGAAGGAGGAGGCCTCGTTCGACCTGCCGCTCTTCAGCTCCGGTAACACCGAGCGCTGCACCCTACAGGTGTGTGTGATGCACCGGGCGCTGGTGGGACCCGATAAAACACTCGGACAGGCGAGCATCAACCTGCTGGAGCTCCAGGACAACACATCCCGAGAGAAAACCGAATGGTTCAAACTGTTGGGCAAGACAGGGAAGGCTGACAAAGACCGAGGAGAAGTCCTTCTAGACATCCAATTCATGAAGAACAACATGACGGCCAGCATGTACGATCTCTCCAGCGTACGCCCCAAAATTCCCCATTATTTTTCCTCTCTTCTTAAATGA

Function

GO:

id name namespace
GO:0045055 regulated exocytosis biological_process
GO:0043231 intracellular membrane-bounded organelle cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-091204-322 Predicted to be involved in regulated exocytosis. Predicted to be active in intracellular membrane-bounded organelle. Orthologous to human RAB11FIP1 (RAB11 family interacting protein 1).

Ensembl:

ensembl_id ENSDART00000052971

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006123 lncRNA downstream 461486 40851137 ~ 40857097 (-) True XLOC_003028
TCONS_00005779 lncRNA downstream 696628 40620981 ~ 40621955 (-) True XLOC_003023
TCONS_00005521 lncRNA downstream 819374 40498159 ~ 40499209 (-) True XLOC_003005
TCONS_00005520 lncRNA downstream 827946 40489637 ~ 40490637 (-) True XLOC_003004
TCONS_00006122 lncRNA downstream 2228495 39087325 ~ 39090088 (-) True XLOC_002973
TCONS_00005562 lncRNA upstream 15606 41368108 ~ 41368637 (-) True XLOC_003034
TCONS_00006124 lncRNA upstream 630407 41982909 ~ 41986276 (-) False XLOC_003040
TCONS_00006126 lncRNA upstream 630407 41982909 ~ 41986363 (-) False XLOC_003040
TCONS_00006125 lncRNA upstream 630407 41982909 ~ 41986363 (-) False XLOC_003040
TCONS_00005781 lncRNA upstream 630407 41982909 ~ 41986363 (-) False XLOC_003040
TCONS_00005555 mRNA downstream 15674 41279007 ~ 41302909 (-) False XLOC_003032
TCONS_00005554 mRNA downstream 15674 41279007 ~ 41302909 (-) False XLOC_003032
TCONS_00005553 mRNA downstream 15674 41279007 ~ 41302909 (-) False XLOC_003032
TCONS_00005557 mRNA downstream 15742 41279665 ~ 41302841 (-) True XLOC_003032
TCONS_00005556 mRNA downstream 33348 41279661 ~ 41285235 (-) False XLOC_003032
TCONS_00005560 mRNA upstream 9888 41362390 ~ 41397663 (-) False XLOC_003034
TCONS_00005561 mRNA upstream 9888 41362390 ~ 41400049 (-) False XLOC_003034
TCONS_00005563 mRNA upstream 56753 41409255 ~ 41450367 (-) False XLOC_003035
TCONS_00005564 mRNA upstream 56762 41409264 ~ 41450454 (-) True XLOC_003035
TCONS_00005565 mRNA upstream 272209 41624711 ~ 41664427 (-) True XLOC_003036
TCONS_00005547 other downstream 415346 40903121 ~ 40903237 (-) True XLOC_003029
TCONS_00005540 other downstream 577136 40741330 ~ 40741447 (-) True XLOC_003024
TCONS_00005531 other downstream 780536 40537440 ~ 40538047 (-) True XLOC_003015
TCONS_00005526 other downstream 797483 40520823 ~ 40521100 (-) True XLOC_003010
TCONS_00005525 other downstream 800985 40516749 ~ 40517598 (-) True XLOC_003009
TCONS_00005570 other upstream 617389 41969891 ~ 41979664 (-) True XLOC_003039
TCONS_00005579 other upstream 759070 42111572 ~ 42131408 (-) True XLOC_003044
TCONS_00005596 other upstream 1559431 42911933 ~ 42912047 (-) True XLOC_003057
TCONS_00005598 other upstream 1640344 42992846 ~ 43028806 (-) True XLOC_003058
TCONS_00005609 other upstream 2183458 43535960 ~ 43536095 (-) True XLOC_003064

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000158_00387142_00400130.mRNA True 1080 mRNA 0.53 3 CI01000158 387142 ~ 400130 (-)