RNA id: TCONS_00071610


Basic Information

Item Value
RNA id TCONS_00071610
length 286
lncRNA type retained_intron
GC content 0.53
exon number 2
gene id XLOC_036672
representative False

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 43668476 ~ 43721359 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTTTCTTTCGCAGAGGTCAATTGTAAACCACTGTCATTTAACGATAGTTTTTGTTCTCTGCTGAAAGGTGGAGATGTGGTGAAGGTTGCTCAGCTGGTGGGTCAGAGTCGGATCGCTCAGCCGGAGACTCCAGTGACCCTGCAGTTTCAGGGAAACAAGTTCACCTTGTCCCAGAGTCAGCTGCGTCAGCTCACCACCGGCCAACCCCTGCAGCTTCAAGGTAACATCCTGCAGATTGTGTCAGCTCCTGGACAGCCTCTTCTCAGGCCTCAGGGGCCACCTATGG

Function

GO:

id name namespace
GO:0005524 ATP binding molecular_function
GO:0003677 DNA binding molecular_function

KEGG:

id description
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-081104-186 Predicted to enable ATP binding activity and hydrolase activity. Predicted to act upstream of or within chromatin organization. Predicted to be located in nucleus. Orthologous to human EP400 (E1A binding protein p400).

Ensembl:

ensembl_id ENSDART00000162674

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00071605 lncRNA downstream 308468 43385738 ~ 43386842 (-) True XLOC_036671
TCONS_00072080 lncRNA downstream 622887 43059687 ~ 43072423 (-) False XLOC_036669
TCONS_00072081 lncRNA downstream 622901 43059762 ~ 43072409 (-) True XLOC_036669
TCONS_00072079 lncRNA downstream 1910537 41784473 ~ 41784773 (-) True XLOC_036660
TCONS_00072078 lncRNA downstream 1910893 41783996 ~ 41784417 (-) True XLOC_036659
TCONS_00071614 lncRNA upstream 50059 43745772 ~ 43746364 (-) False XLOC_036673
TCONS_00071620 lncRNA upstream 238882 43934595 ~ 43940177 (-) True XLOC_036676
TCONS_00071636 lncRNA upstream 537126 44232839 ~ 44234512 (-) False XLOC_036680
TCONS_00072509 lncRNA upstream 537126 44232839 ~ 44238627 (-) False XLOC_036680
TCONS_00072510 lncRNA upstream 537126 44232839 ~ 44299247 (-) False XLOC_036680
TCONS_00071607 mRNA downstream 5986 43671200 ~ 43689324 (-) False XLOC_036672
TCONS_00071608 mRNA downstream 17548 43672075 ~ 43677762 (-) False XLOC_036672
TCONS_00071602 mRNA downstream 120375 43379436 ~ 43574935 (-) False XLOC_036671
TCONS_00071604 mRNA downstream 239285 43381614 ~ 43456025 (-) False XLOC_036671
TCONS_00071603 mRNA downstream 239285 43381614 ~ 43456025 (-) False XLOC_036671
TCONS_00071611 mRNA upstream 16511 43712224 ~ 43716897 (-) True XLOC_036672
TCONS_00071612 mRNA upstream 40359 43736072 ~ 43775805 (-) False XLOC_036673
TCONS_00071613 mRNA upstream 40429 43736142 ~ 43750062 (-) False XLOC_036673
TCONS_00071615 mRNA upstream 60272 43755985 ~ 43775820 (-) True XLOC_036673
TCONS_00071616 mRNA upstream 119108 43814821 ~ 43835603 (-) False XLOC_036674
TCONS_00071599 other downstream 790668 42860031 ~ 42904642 (-) True XLOC_036668
TCONS_00071593 other downstream 1126084 42549138 ~ 42569226 (-) False XLOC_036665
TCONS_00071589 other downstream 1186804 42508390 ~ 42508506 (-) True XLOC_036664
TCONS_00071588 other downstream 1342993 42352201 ~ 42352317 (-) True XLOC_036663
TCONS_00071587 other downstream 1561191 42134003 ~ 42134119 (-) True XLOC_036662
TCONS_00071629 other upstream 345083 44040796 ~ 44040913 (-) True XLOC_036678
TCONS_00071640 other upstream 644791 44340504 ~ 44341615 (-) False XLOC_036682
TCONS_00071642 other upstream 645828 44341541 ~ 44344742 (-) True XLOC_036682
TCONS_00071656 other upstream 1505147 45200860 ~ 45202077 (-) True XLOC_036696
TCONS_00071662 other upstream 1715868 45411581 ~ 45411745 (-) True XLOC_036699

Expression Profile

//