RNA id: TU120659


Basic Information

Item Value
RNA id TU120659
length 269
RNA type TUCP
GC content 0.51
exon number 2
gene id G96766
representative True

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 6698857 ~ 6700357 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

GTTGATATTATTCCTTGCAGGATGAACACTGCTTAATAATGATCTTGCCTCACATCGTTGGACTGTCTCTACTTTTTGGAGTCTCTACTGCAGTGCTGGTGTCCAGCTCCCCCATGGTGGTGGCTCCAGGCAGTGACATCACCCTCAGTTGCTCTTTCCACTATAGTGAAGCTGATGACCCTGGCAGAGTGGTGCTGACCTGGCATCGAGGTCAGGAGGTTGTGCACAGTTTCTATTACGGCACAGATCAGCTGAAGGAACAAAGCCCC

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU120631 lncRNA downstream 286148 6410647 ~ 6412709 (-) True AMCG00015271
TU120566 lncRNA downstream 336448 6355020 ~ 6362409 (-) True G96696
TU120513 lncRNA downstream 470081 6228514 ~ 6228776 (-) True G96653
TU120510 lncRNA downstream 475228 6157103 ~ 6223629 (-) True G96650
TU120497 lncRNA downstream 577855 6120654 ~ 6121002 (-) True G96643
TU120734 lncRNA upstream 170105 6870462 ~ 6871498 (-) True AMCG00015283
TU120743 lncRNA upstream 190878 6891235 ~ 6892166 (-) True AMCG00015285
TU120746 lncRNA upstream 194723 6895080 ~ 6896427 (-) False AMCG00015285
TU120800 lncRNA upstream 287043 6987400 ~ 7063937 (-) True G96873
TU120912 lncRNA upstream 572554 7272911 ~ 7277373 (-) True G96967
AMCG00015278 mRNA downstream 7476 6672892 ~ 6691381 (-) True AMCG00015278
AMCG00015274 mRNA downstream 89430 6608049 ~ 6609427 (-) True AMCG00015274
AMCG00015275 mRNA downstream 107857 6590193 ~ 6591000 (-) True AMCG00015275
AMCG00015273 mRNA downstream 173050 6515366 ~ 6525807 (-) True AMCG00015273
AMCG00015272 mRNA downstream 197638 6488442 ~ 6501219 (-) True AMCG00015272
AMCG00015279 mRNA upstream 31135 6731492 ~ 6765254 (-) True AMCG00015279
AMCG00015282 mRNA upstream 134846 6835203 ~ 6854561 (-) True AMCG00015282
AMCG00015283 mRNA upstream 170386 6870743 ~ 6877734 (-) False AMCG00015283
AMCG00015287 mRNA upstream 183687 6884044 ~ 6885454 (-) True AMCG00015287
AMCG00015285 mRNA upstream 191073 6891430 ~ 6895164 (-) False AMCG00015285
TU120625 other downstream 314237 6377890 ~ 6384620 (-) True AMCG00015267
TU120487 other downstream 634698 6049477 ~ 6064159 (-) False AMCG00015256
TU120336 other downstream 941748 5755654 ~ 5757109 (-) False AMCG00015244
TU120133 other downstream 1625051 5054901 ~ 5073806 (-) False AMCG00015211
TU120090 other downstream 1693345 4985572 ~ 5005512 (-) False AMCG00015211
TU120782 other upstream 217409 6917766 ~ 6921641 (-) False AMCG00015288
TU121101 other upstream 1085730 7786087 ~ 7786442 (-) True G97125
TU121448 other upstream 1430950 8131307 ~ 8134115 (-) False G97411
TU121510 other upstream 1709630 8409987 ~ 8411882 (-) True G97455
TU121587 other upstream 1840831 8541188 ~ 8543180 (-) False AMCG00015374

Expression Profile