G246753


Basic Information

Item Value
gene id G246753
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 4949553 ~ 4952336 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU280040
TCCTGCACTGCTTGTTGTACTCCTCTATCCCCATCTTCGCCACATCCTCAGGTCCTTTGATATTCAGAGATTTATCAATCTCATATTCCACAGGCAGGCCGTGACAGTCCCAGCCGAAGCGCCGGTCCACGTGGAAGCCGTTCTGATGGGCAAACCTGGTCACAATGTCCTTGATGGTTCCGGCCAGGATGTGGCCATAGTGAGGCAGACCGGTGGCAAAGGGCGGCCCGTCATAGAACGTGAACCTGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU280040 True 249 lncRNA 0.55 2 4949553 4952336

Neighbor

gene id symbol gene type direction distance location
CI01000057_04927533_04931127 CDK4 coding downstream 18426 4927533 ~ 4931420 (-)
CI01000057_04916382_04926437 ARFGAP1 coding downstream 23116 4916287 ~ 4926437 (-)
CI01000057_04891502_04906844 ELMO2 coding downstream 42709 4890235 ~ 4906844 (-)
CI01000057_04866089_04878847 ITGA7 coding downstream 70706 4866089 ~ 4878847 (-)
CI01000057_04861618_04865902 ITGA7 coding downstream 83651 4861618 ~ 4865902 (-)
CI01000057_05163258_05169859 NA coding upstream 210304 5162640 ~ 5170119 (-)
CI01000057_05442832_05459768 VGLL4 coding upstream 490448 5442784 ~ 5459768 (-)
CI01000057_05464070_05466835 NA coding upstream 511704 5464040 ~ 5469344 (-)
CI01000057_05486207_05495209 TAMM41 coding upstream 533704 5486040 ~ 5495657 (-)
CI01000057_05553430_05562372 NA coding upstream 599222 5551558 ~ 5562448 (-)
G246751 NA non-coding downstream 2931 4946387 ~ 4946622 (-)
G246750 NA non-coding downstream 3801 4945398 ~ 4945752 (-)
G246682 NA non-coding downstream 12381 4936951 ~ 4937172 (-)
G246703 NA non-coding downstream 86371 4862804 ~ 4863182 (-)
G246763 NA non-coding upstream 11005 4963341 ~ 4963540 (-)
G246764 NA non-coding upstream 16697 4969033 ~ 4969962 (-)
G246793 NA non-coding upstream 111052 5063388 ~ 5093263 (-)
G246782 NA non-coding upstream 128933 5081269 ~ 5083402 (-)
G246780 NA non-coding upstream 133976 5086312 ~ 5283617 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other downstream 1051862 3887203 ~ 3892054 (-)
CI01000057_01904867_01921400 NA other downstream 3028132 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other downstream 3144400 1801528 ~ 1806454 (-)
G244358 NA other downstream 4378525 570530 ~ 571028 (-)
CI01000057_05925181_05926068 NA other upstream 971204 5923540 ~ 5927295 (-)

Expression


Co-expression Network