G266299


Basic Information

Item Value
gene id G266299
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 7026047 ~ 7026289 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU302245
GCCTCATTAATATGCAGCTCATTAGAGGTCTTTATGCGATTCTTTTGTCTTCTCAGGTGTAAATCACCCATTATTCATGATGATTCACGCCTCCATGCATACTGTGTTTCTTGACAAAAAGTGTCTTACAAAAACTAAATCAATATATTGTTATAAATGAACGAGTATGCAGGATAATTTTTACATCATTTTGAAGCAAAAACTCTAGTCTACAACCTCCAATACCCAGAAGTCTTGTGAACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU302245 True 243 lncRNA 0.35 1 7026047 7026289

Neighbor

gene id symbol gene type direction distance location
CI01000063_07012391_07014164 NA coding upstream 9672 7012225 ~ 7016375 (+)
CI01000063_06990713_06993818 NA coding upstream 32195 6990640 ~ 6993852 (+)
CI01000063_06982270_06983358 UTS2R coding upstream 42592 6981946 ~ 6983455 (+)
CI01000063_06928230_06954632 CACNA1G coding upstream 71415 6928230 ~ 6954632 (+)
CI01000063_06733190_06869248 CACNA1G coding upstream 156799 6733190 ~ 6869248 (+)
CI01000063_07079516_07080598 UTS2R coding downstream 52894 7079183 ~ 7081349 (+)
CI01000063_07120937_07121851 CDK5R1B, CDK5R1 coding downstream 94313 7120602 ~ 7125013 (+)
CI01000063_07197046_07197411 NA coding downstream 170353 7196642 ~ 7197504 (+)
CI01000063_07199941_07203985 NA coding downstream 172808 7199097 ~ 7204038 (+)
CI01000063_07252228_07279272 TBKBP1 coding downstream 225761 7252050 ~ 7280398 (+)
G266294 NA non-coding upstream 4538 7021305 ~ 7021509 (+)
G266176 NA non-coding upstream 372078 6651817 ~ 6653969 (+)
CI01000063_06408168_06418415 NBR1 non-coding upstream 606721 6407762 ~ 6419326 (+)
G265463 NA non-coding upstream 687180 6338652 ~ 6338867 (+)
G265460 NA non-coding upstream 702423 6323277 ~ 6323624 (+)
G266208 NA non-coding downstream 88748 7115037 ~ 7117317 (+)
G266171 NA non-coding downstream 102027 7128316 ~ 7149391 (+)
G266375 NA non-coding downstream 188551 7214840 ~ 7215096 (+)
G266213 NA non-coding downstream 196350 7222639 ~ 7223196 (+)
CI01000063_06335618_06338138 HOXB8B other upstream 688687 6335618 ~ 6338283 (+)
G265391 NA other upstream 1107018 5913783 ~ 5919029 (+)
G262436 NA other upstream 4311530 2713615 ~ 2714517 (+)
G262423 NA other upstream 4783082 2241408 ~ 2242965 (+)
G262194 NA other upstream 5881040 1139352 ~ 1145007 (+)

Expression


Co-expression Network