G287627


Basic Information

Item Value
gene id G287627
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000073
NCBI id null
chromosome length 1307889
location 383722 ~ 383925 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU326080
AGGGCTAACTGGATTTAGTTTTAATTAATTAATTTTGTTTTGATCCATTAAAAATTGAAACGACATGAGGGTGAGTAAATGATGACAGAAGTTTAATTTTTCGGTGAACTAACCCTTTAAATGTTGACATGATACTTTTAGGTTCAACGGGTTTTTAATATTTAATGGATCAAAACAAAATCAATCAATTAAAGCTAAATCCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU326080 True 204 lncRNA 0.28 1 383722 383925

Neighbor

gene id symbol gene type direction distance location
CI01000073_00334163_00334633 NA coding upstream 48535 333832 ~ 335187 (+)
CI01000073_00275690_00276754 NA coding upstream 105897 275690 ~ 277825 (+)
CI01000073_00262918_00263376 NA coding upstream 120105 262918 ~ 263617 (+)
CI01000073_00249780_00250877 NA coding upstream 132572 249780 ~ 251150 (+)
CI01000073_00116439_00125912 ACVR2B coding upstream 257620 116439 ~ 126102 (+)
CI01000073_00384381_00387601 VIML coding downstream 357 384282 ~ 387601 (+)
CI01000073_00396614_00407516 NA coding downstream 11889 395814 ~ 407946 (+)
CI01000073_00478931_00488750 PDE1C, PDE1CB coding downstream 94931 478856 ~ 488754 (+)
CI01000073_00496969_00501063 NA coding downstream 113044 496969 ~ 501206 (+)
CI01000073_00509393_00517498 MCM6L coding downstream 125468 509393 ~ 517611 (+)
G287609 NA non-coding upstream 2162 381336 ~ 381560 (+)
G287476 NA non-coding upstream 34495 346929 ~ 349227 (+)
G287471 NA non-coding upstream 38132 341834 ~ 345590 (+)
G287456 NA non-coding upstream 54161 329252 ~ 329561 (+)
G287457 NA non-coding upstream 56385 323693 ~ 327337 (+)
G287670 NA non-coding downstream 119650 503575 ~ 504488 (+)
G287672 NA non-coding downstream 124253 508178 ~ 508602 (+)
G287685 NA non-coding downstream 176661 560586 ~ 560917 (+)
G287650 NA non-coding downstream 335251 719176 ~ 722946 (+)
G287654 NA non-coding downstream 350284 734209 ~ 736197 (+)
G287391 NA other upstream 183950 190944 ~ 199772 (+)
CI01000073_00048073_00049706 NA other upstream 292999 47933 ~ 50512 (+)
G287638 NA other downstream 325119 709044 ~ 718401 (+)

Expression


Co-expression Network