CI01000086_02403053_02403317 (ZNRF2)


Basic Information

Item Value
gene id CI01000086_02403053_02403317
gene name ZNRF2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000086
NCBI id null
chromosome length 2920448
location 2402872 ~ 2403317 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000086_02403053_02403317.mRNA
AGGACGTCCTGGCGAAGGACACAGGAGAATGTGCAATATGTCTGGAGGATCTGGTCCAGGGAGACACCATCGCACGCCTGCCCTGCCTCTGCATCTATCACAAAGGTTGTATTGATGAGTGGTTTGAAGTGAACCGATCGTGTCCTGAACATCCTTCAGATTAAAAGCGCCTCTCACACCTTTGCACAGGTAACACACATTCACACTCCCGAATCAAGTAAATTCATGTTTACATTGGTGACTCTTATTAATGTCAGAGAGATCCTTCACTTATTGACATTATGGCATTTAAATGCATGTGCATAATATACATAAATATACTGTACGTTACATTGCAAAAATAAA

Function

symbol description
znrf2 Enables ubiquitin protein ligase activity. Predicted to be involved in protein ubiquitination. Located in cytoplasmic vesicle membrane; nuclear lumen; and plasma membrane. Part of protein-containing complex.

GO:

id name namespace
GO:0008766 UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate-D-alanyl-D-alanine ligase activity molecular_function

KEGG:

id description
K10694 ZNRF1_2; E3 ubiquitin-protein ligase ZNRF1/2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000086_02403053_02403317.mRNA True 345 mRNA 0.42 2 2402872 2403317

Neighbor

gene id symbol gene type direction distance location
CI01000086_02400288_02400580 NA coding downstream 2264 2399858 ~ 2400608 (-)
CI01000086_02366362_02373059 SLC6A20 coding downstream 29813 2364331 ~ 2373059 (-)
CI01000086_02192695_02193522 NA coding downstream 209106 2192635 ~ 2193766 (-)
CI01000086_02032793_02044182 BRD9 coding downstream 358690 2032712 ~ 2044182 (-)
CI01000086_02018950_02030464 NA coding downstream 372347 2018820 ~ 2030525 (-)
CI01000086_02543856_02545475 FZD1, FZD1.L coding upstream 139051 2542368 ~ 2545808 (-)
CI01000086_02610598_02642920 CDK14 coding upstream 207250 2610567 ~ 2642920 (-)
CI01000086_02886112_02888612 KDF1A coding upstream 482130 2885447 ~ 2890213 (-)
CI01000086_02893723_02895660 NA coding upstream 490104 2893421 ~ 2895833 (-)
CI01000086_02897831_02901375 TMEM222, TMEM222A, TMEM222B coding upstream 494487 2897804 ~ 2901375 (-)
G299606 NA non-coding downstream 17708 2381035 ~ 2385164 (-)
G299616 NA non-coding downstream 51589 2346302 ~ 2351283 (-)
G299718 NA non-coding downstream 68630 2334009 ~ 2334242 (-)
G299717 NA non-coding downstream 69332 2333275 ~ 2333540 (-)
G299716 NA non-coding downstream 69722 2332914 ~ 2333150 (-)
G299734 NA non-coding upstream 53810 2457127 ~ 2457340 (-)
G299739 NA non-coding upstream 60184 2463501 ~ 2463712 (-)
G299765 NA non-coding upstream 97815 2501132 ~ 2501412 (-)
G299766 NA non-coding upstream 98111 2501428 ~ 2501664 (-)
G299770 NA non-coding upstream 102873 2506190 ~ 2511270 (-)
CI01000086_01852638_01897719 UBR5 other downstream 499453 1852146 ~ 1897719 (-)
G299528 NA other downstream 707695 1668206 ~ 1695177 (-)
CI01000086_01257926_01260025 SERPINB1L4, SERPINB14 other downstream 1141635 1257926 ~ 1260025 (-)
G299107 NA other downstream 1276074 1126738 ~ 1126798 (-)
G299173 NA other downstream 1634993 765617 ~ 767879 (-)
G299598 NA other upstream 462365 2865682 ~ 2868103 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_011105 znrf2b coding NC_007127.7 CM002900.2 53733714 ~ 53800047 (-)
grasscarp (Ctenopharyngodon idella) G151904 NA non-coding CI01000029 null 1004177 ~ 1004713 (+)