G313419


Basic Information

Item Value
gene id G313419
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000098
NCBI id null
chromosome length 3223972
location 878359 ~ 878987 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU356321
GGGTAAACCTCATGTTGTTCCATTTGTCTGTTGAACACATTGGGAGATAATACACAGAATCTTACCTTTAGTGACCATTCACTATCAACAGTATGCAATGAAAAAGTTGTCAAATTTACTTATACAGCGCTTTTCACAATAAACATTTTCTAACATTCTACCTAACATCTCTTAGCCTGACACTGAATAAAATGACATGTTCGGAAAAACTACAGATTAAACAATAATAAAATGGTTGTTAGTTGTATAGTTAATATGAGAGGAAACATGTATTTAAGTCTAAAATAAGAAAGTTCTGTTACACAATATTAAGCAGAATCATGCAGTAAACAACATTGAGATACAATGATTTGCATATGTAACAAGCGCAATGCACCATGACATACTATGCTAGTACCTCATGTCATTGTGTACTACGTCACAGAAGTTAACGCTTTTTGGACGTACGTCGAATGCGTATGGCTGTCGTTATTTTACTTTATAAAGTTTTAAATAAGGATACTTGTCTTAAACAAATGCATCGATTCGCTTCAGAAGGCCTTTATTAACCCCCTGGAGTCGTATGGATTCATTTTTTTTTATGGATGGATTCATTCATTTTTTTTGTCTTCAAAATGTGGGCTACCATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU356321 True 629 lncRNA 0.33 1 878359 878987

Neighbor

gene id symbol gene type direction distance location
CI01000098_00791105_00826150 MOV10L1 coding upstream 52195 791105 ~ 826164 (+)
CI01000098_00652733_00677992 PHLPP1 coding upstream 199149 652733 ~ 679210 (+)
CI01000098_00470832_00473215 NA coding upstream 404719 470429 ~ 473640 (+)
CI01000098_00438241_00447948 USP14 coding upstream 430343 438241 ~ 448016 (+)
CI01000098_00301943_00303337 NA coding upstream 574815 301943 ~ 303544 (+)
CI01000098_00894309_00897316 NA coding downstream 15322 894309 ~ 897387 (+)
CI01000098_00899135_00921462 NA coding downstream 20090 899077 ~ 921724 (+)
CI01000098_00987638_00993102 NA coding downstream 108651 987638 ~ 993102 (+)
CI01000098_00996891_01000102 NA coding downstream 117904 996891 ~ 1000275 (+)
CI01000098_01071463_01072189 NA coding downstream 192476 1071463 ~ 1072428 (+)
G313418 NA non-coding upstream 131 877932 ~ 878228 (+)
G313401 NA non-coding upstream 30796 847328 ~ 847563 (+)
G313396 NA non-coding upstream 36189 840956 ~ 842170 (+)
G313376 NA non-coding upstream 98781 779305 ~ 779578 (+)
G313343 NA non-coding upstream 104774 771859 ~ 773585 (+)
G313448 NA non-coding downstream 1222 880209 ~ 880603 (+)
G313441 NA non-coding downstream 44489 923476 ~ 931334 (+)
G313456 NA non-coding downstream 79545 958532 ~ 958788 (+)
G313457 NA non-coding downstream 79840 958827 ~ 959068 (+)
G313447 NA non-coding downstream 82291 961278 ~ 961511 (+)
G313412 NA other upstream 12412 864629 ~ 865947 (+)
CI01000098_00274963_00275658 NA other upstream 603102 274731 ~ 275712 (+)
G314121 NA other downstream 876153 1755140 ~ 1760972 (+)
G314278 NA other downstream 1350337 2229324 ~ 2234831 (+)
CI01000098_02167217_02267829 NA other downstream 1369129 2167217 ~ 2267829 (+)
G314652 NA other downstream 2322533 3201520 ~ 3204360 (+)

Expression


Co-expression Network