G316711


Basic Information

Item Value
gene id G316711
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000105
NCBI id null
chromosome length 3526334
location 1615342 ~ 1616418 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU360138
AGCTACGCAGTTATCATTACTGATGTTACAAATGTCTATTCAGGAATAAGGGCTGACATGATTTTTAATTAATAGCATGAGCTTCAGGATTTATTTTAAATTTGAGAAAGGGAAAATTAAAGGTGCAGTAAGCAATTTCTGAGAAATACTATTGAAAGTGGATCAGACCGAGCACCACAACACTCTTGTAGCCAATCAGCAGGAGGGGGCGTGTCCACTCATGATGTGGGAGGAGAGAGAGTGAGCCAATCAGTAGGAGGGGGCGTGTCCACTCATGATGGGGGAGGAGAGAGACCGAGCCAATCAGCAGGAGGGGGCGTGTCCACTCACGATGGGAAAGGAGAGAGAATGCGCAGCTGGTATCGGTGTATCGATAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU360138 True 377 lncRNA 0.46 2 1615342 1616418

Neighbor

gene id symbol gene type direction distance location
CI01000105_01594096_01594462 NA coding downstream 20880 1592933 ~ 1594462 (-)
CI01000105_01579475_01580951 KBTBD13 coding downstream 34391 1579475 ~ 1580951 (-)
CI01000105_01513919_01516318 SPG21 coding downstream 99024 1513919 ~ 1516318 (-)
CI01000105_01364107_01364379 NA coding downstream 248639 1361342 ~ 1366703 (-)
CI01000105_01181447_01186008 RPLP2, RPLP2L coding downstream 429334 1181422 ~ 1186008 (-)
CI01000105_01633375_01636353 RLBP1 coding upstream 15717 1632135 ~ 1636353 (-)
CI01000105_01638030_01639731 NA coding upstream 21431 1637849 ~ 1639943 (-)
CI01000105_01674679_01675478 NA coding upstream 58211 1674629 ~ 1675663 (-)
CI01000105_01891362_01892340 NA coding upstream 274612 1883143 ~ 1893784 (-)
CI01000105_01904038_01936686 KIF7 coding upstream 287267 1903685 ~ 1936686 (-)
G316678 NA non-coding downstream 112575 1502357 ~ 1502767 (-)
G316613 NA non-coding downstream 138149 1467371 ~ 1477193 (-)
G316649 NA non-coding downstream 169136 1445997 ~ 1446206 (-)
G316647 NA non-coding downstream 170342 1444737 ~ 1445000 (-)
G316646 NA non-coding downstream 170610 1444515 ~ 1444732 (-)
G316684 NA non-coding upstream 6428 1622846 ~ 1631464 (-)
G316714 NA non-coding upstream 33030 1649448 ~ 1649723 (-)
G316715 NA non-coding upstream 34237 1650655 ~ 1651236 (-)
G316717 NA non-coding upstream 36729 1653147 ~ 1653386 (-)
G316719 NA non-coding upstream 51008 1667426 ~ 1667631 (-)
G316592 NA other downstream 220370 1336036 ~ 1394972 (-)
G316296 NA other downstream 1229149 382583 ~ 386193 (-)
G316716 NA other upstream 35875 1652293 ~ 1652634 (-)
G317081 NA other upstream 417211 2033629 ~ 2094009 (-)
G317127 NA other upstream 590955 2207373 ~ 2208081 (-)

Expression


Co-expression Network