G330404


Basic Information

Item Value
gene id G330404
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 4149987 ~ 4150244 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU375569
TAGCAACCAAAAAAACTAGCATAATTTTGAAAAAGGTGAATATTCCAAAGGAATGGTGTGTATGTGTGTCCTGGTATGGGACCACATGTCCCCACAGGTAAAGTAATACCAATGCATTTTGACTTTGTGGGGACATTTTTAAAGTCCCCATGAGGAAACAAGCTTATACATAAATCATACAGAATGATGTTTTCTCAACATCTAAAATAGCAGAATGTTTTCTGTCATGGGTAGGTCTAGTGGTAAGGTTAGTGTAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU375569 True 258 lncRNA 0.37 1 4149987 4150244

Neighbor

gene id symbol gene type direction distance location
CI01000112_04055598_04089942 NA coding upstream 59451 4055598 ~ 4090536 (+)
CI01000112_04050993_04055507 NA coding upstream 94480 4050993 ~ 4055507 (+)
CI01000112_04036511_04048219 NA coding upstream 101655 4036511 ~ 4048332 (+)
CI01000112_04033996_04035285 NA coding upstream 114650 4033893 ~ 4035337 (+)
CI01000112_04020422_04027554 NA coding upstream 122241 4020284 ~ 4027746 (+)
CI01000112_04264297_04265684 NA coding downstream 113469 4263713 ~ 4265972 (+)
CI01000112_04346478_04353682 NA coding downstream 195459 4345703 ~ 4354299 (+)
CI01000112_04561557_04563086 NA coding downstream 411211 4561455 ~ 4563190 (+)
CI01000112_04579149_04582002 NA coding downstream 428905 4579149 ~ 4582164 (+)
CI01000112_04918167_04937803 NA coding downstream 767737 4917981 ~ 4938884 (+)
G330402 NA non-coding upstream 1123 4148519 ~ 4148864 (+)
G330383 NA non-coding upstream 45486 4104238 ~ 4104501 (+)
G329512 NA non-coding upstream 176104 3972116 ~ 3973883 (+)
G329513 NA non-coding upstream 223811 3859478 ~ 3926176 (+)
G329517 NA non-coding upstream 267043 3811534 ~ 3882944 (+)
G330396 NA non-coding downstream 5155 4155399 ~ 4157165 (+)
G330433 NA non-coding downstream 44422 4194666 ~ 4194913 (+)
G330450 NA non-coding downstream 70510 4220754 ~ 4221630 (+)
G330453 NA non-coding downstream 77528 4227772 ~ 4227997 (+)
G330454 NA non-coding downstream 78384 4228628 ~ 4228892 (+)
G329194 NA other upstream 1218098 2920254 ~ 2931889 (+)
G329125 NA other upstream 1531836 2617704 ~ 2618151 (+)
G328456 NA other upstream 2916869 1232022 ~ 1233118 (+)
CI01000112_05076817_05101845 NA other downstream 934476 5076817 ~ 5101845 (+)

Expression


Co-expression Network