G363384


Basic Information

Item Value
gene id G363384
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000158
NCBI id null
chromosome length 1938735
location 1021530 ~ 1022475 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU414497
CACCTTCAGGAGCACCTTCTTACGAGAAGCCATCCTTGTGGACTAAACTGTGCCTGATTTCTGAGGAGAAATCCCACCGTCGGCGCAACAATCTTCTGCTGTCATACAACAAAAACAACCAAACTTGACACCTCCACCGTCTCTGATCAGCTCTGGACACACTCTGTGGGTCGTGTTGCGTGTTTTTGGATGGTTGTCACGGTCAGTTCAGCACATCCGTGTGTAATAATGAGCCGCAAACACTCCCTCCCTTGACTCAGCTCAATACTCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU414497 True 271 lncRNA 0.50 2 1021530 1022475

Neighbor

gene id symbol gene type direction distance location
CI01000158_00983889_00993672 RHOBTB2 coding upstream 27476 983889 ~ 994054 (+)
CI01000158_00955930_00956923 NA coding upstream 63765 955090 ~ 957765 (+)
CI01000158_00923138_00936354 FGFR1B coding upstream 83739 923138 ~ 937791 (+)
CI01000158_00885015_00891759 KCTD9B, KCTD9 coding upstream 129291 885015 ~ 892239 (+)
CI01000158_00878419_00882435 ACTY, ACTR1, ACTR1A, ACTR1A.L, ACTR1B coding upstream 139095 878108 ~ 882435 (+)
CI01000158_01216424_01216750 NA coding downstream 193288 1215763 ~ 1217237 (+)
CI01000158_01221423_01241226 ATG10 coding downstream 198948 1221423 ~ 1241431 (+)
CI01000158_01271157_01297723 XRCC4 coding downstream 248682 1271157 ~ 1298361 (+)
CI01000158_01309383_01335186 VCAN coding downstream 286908 1309383 ~ 1335400 (+)
CI01000158_01392749_01393057 NA coding downstream 370274 1392749 ~ 1393285 (+)
G363369 NA non-coding upstream 4734 1014803 ~ 1016796 (+)
G363381 NA non-coding upstream 25445 995015 ~ 996085 (+)
G363418 NA non-coding upstream 48929 972179 ~ 972601 (+)
G363410 NA non-coding upstream 124682 896617 ~ 896848 (+)
G363354 NA non-coding upstream 189927 831257 ~ 831603 (+)
G363448 NA non-coding downstream 34169 1056644 ~ 1056855 (+)
G363449 NA non-coding downstream 35547 1058022 ~ 1058244 (+)
G363453 NA non-coding downstream 39685 1062160 ~ 1062368 (+)
G363454 NA non-coding downstream 41550 1064025 ~ 1064306 (+)
G363528 NA non-coding downstream 189428 1211903 ~ 1212244 (+)
CI01000158_01687966_01688623 CRYBA4 other downstream 665492 1687966 ~ 1688784 (+)

Expression


Co-expression Network