G366442


Basic Information

Item Value
gene id G366442
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000161
NCBI id null
chromosome length 3087367
location 999600 ~ 999819 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU418142
ACCAGTCAGAGTGATTTAGCAACTGCATTACATAGCATTAATACAAGTAAAACAACTAGAGATGATGTTTTAGAAAATAAGTTCTAAATTTAGACAAACTATAAATAGATGTTCAATTCTTTGAATTCTCTTAGGAATTCAAAGAAATGAAATAACTGACAAATTAGCGAAAACAACATTAAAACATAATGACAAAACAGAGATAATTAATTAAAGCAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU418142 True 220 lncRNA 0.26 1 999600 999819

Neighbor

gene id symbol gene type direction distance location
CI01000161_00949785_00955153 NA coding upstream 44371 947517 ~ 955229 (+)
CI01000161_00876668_00908543 AVL9 coding upstream 90638 876408 ~ 908962 (+)
CI01000161_00844727_00861103 SULT1ST6 coding upstream 138497 844727 ~ 861103 (+)
CI01000161_00797352_00821121 NA coding upstream 178164 796437 ~ 821436 (+)
CI01000161_00759861_00780124 TGFI1, TGFB1I1 coding upstream 218141 759069 ~ 781459 (+)
CI01000161_01012565_01040932 ACLYB, ACLY, ACLYA coding downstream 12746 1012565 ~ 1040932 (+)
CI01000161_01044665_01050371 KLHL11 coding downstream 44846 1044665 ~ 1051101 (+)
CI01000161_01072131_01081719 NA coding downstream 72275 1072094 ~ 1081836 (+)
CI01000161_01084125_01132855 NA coding downstream 84306 1084125 ~ 1133007 (+)
CI01000161_01187108_01189802 FOXH1 coding downstream 185635 1185454 ~ 1189865 (+)
G366437 NA non-coding upstream 5883 993201 ~ 993717 (+)
G366350 NA non-coding upstream 324802 674595 ~ 674798 (+)
G366251 NA non-coding upstream 393360 605885 ~ 606240 (+)
G366285 NA non-coding upstream 415920 580430 ~ 583680 (+)
G366284 NA non-coding upstream 416822 579593 ~ 582778 (+)
G366443 NA non-coding downstream 44030 1043849 ~ 1044100 (+)
G366469 NA non-coding downstream 162578 1162397 ~ 1162979 (+)
G366468 NA non-coding downstream 165588 1165407 ~ 1167713 (+)
G366471 NA non-coding downstream 167949 1167768 ~ 1167971 (+)
G366467 NA non-coding downstream 169139 1168958 ~ 1169432 (+)
G366441 NA other upstream 1378 997902 ~ 998222 (+)
CI01000161_01272798_01288327 NA other downstream 288735 1272798 ~ 1289008 (+)
CI01000161_01387036_01388147 LSM5 other downstream 387193 1387012 ~ 1388622 (+)

Expression


Co-expression Network