G366469


Basic Information

Item Value
gene id G366469
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000161
NCBI id null
chromosome length 3087367
location 1162397 ~ 1162979 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU418174
CTTTAATTTTTAGCCAGGGACCTCTGGTTGAGTTGACACAGAATGACCCAGATGTCCTATTTTTTTAATAAGCATGATCTTTATTACTGGAAGCTTAGCGTGTTTCCAATCTGTCATATTTCATATTTCAGAAGGTTTTAAACACTGTATTAGCTCATTTCTCACCAGTGCAGCGTGCAGGTTCAGTTCTGCATCAGTCTGTCGGTCTTCATCATCATCCAGGGCATCTGACTGTTTTCCTCTCTCTTGCCACACCATGGCTTCCTTCTGATGCTCTCTGCGGTACAGACTGCTGCGCTCGTTTACACTGCTGCGCCTCACTACTTTACTGTAAAAACAATCCACACAAAGAAGAGCTCACACACACTGCTTTAGAGGGGTTATTTATATTATCATAATTAACTAAGATCACAAACAACATGATAACACTATTATCTAATCATGAAAAATGGCAACAACAGTATTCCAGTGTAAACGATATAGAAACTGAGCGATGCAACAAAAGTACAGCACTCCAATTATAGTCAGCGAGGCTGTTTCCACGGCATCCACTACAGAATAAACATTACACACTAAAAATTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU418174 True 583 lncRNA 0.40 1 1162397 1162979

Neighbor

gene id symbol gene type direction distance location
CI01000161_01084125_01132855 NA coding upstream 29390 1084125 ~ 1133007 (+)
CI01000161_01072131_01081719 NA coding upstream 80561 1072094 ~ 1081836 (+)
CI01000161_01044665_01050371 KLHL11 coding upstream 111296 1044665 ~ 1051101 (+)
CI01000161_01012565_01040932 ACLYB, ACLY, ACLYA coding upstream 121465 1012565 ~ 1040932 (+)
CI01000161_00949785_00955153 NA coding upstream 207168 947517 ~ 955229 (+)
CI01000161_01187108_01189802 FOXH1 coding downstream 22475 1185454 ~ 1189865 (+)
CI01000161_01236311_01253636 STAT5B, STAT5A, STA5B, STAT5 coding downstream 73332 1236311 ~ 1253946 (+)
CI01000161_01260410_01265135 NA coding downstream 97431 1260410 ~ 1265421 (+)
CI01000161_01272798_01288327 NA coding downstream 109819 1272798 ~ 1289008 (+)
CI01000161_01387036_01388147 LSM5 coding downstream 224057 1387012 ~ 1388622 (+)
G366443 NA non-coding upstream 118297 1043849 ~ 1044100 (+)
G366442 NA non-coding upstream 162578 999600 ~ 999819 (+)
G366437 NA non-coding upstream 168680 993201 ~ 993717 (+)
G366350 NA non-coding upstream 487599 674595 ~ 674798 (+)
G366251 NA non-coding upstream 556157 605885 ~ 606240 (+)
G366468 NA non-coding downstream 2428 1165407 ~ 1167713 (+)
G366471 NA non-coding downstream 4789 1167768 ~ 1167971 (+)
G366467 NA non-coding downstream 5979 1168958 ~ 1169432 (+)
G366474 NA non-coding downstream 9534 1172513 ~ 1172720 (+)
G366475 NA non-coding downstream 14619 1177598 ~ 1177918 (+)
G366441 NA other upstream 164175 997902 ~ 998222 (+)

Expression


Co-expression Network