G419777


Basic Information

Item Value
gene id G419777
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 2941699 ~ 2941947 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU482174
TAACTATGCCCTCAGTGATTGGCTGATGGGGGAGGAGTCTCTGTCAGCGATTTAATCATAGAAATATTGTAGAATGAGGTATCATGTTGCCATATTCAAATAAAGGTTTTAAAATACAAATGTTGCCATATTTAAATAAAGGTTTTAAAATGTAGGCTAAGTGTCACTAATTAAACTAGTATATGTTCAGCTAATTGTCAGCCTCTTACATGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU482174 True 213 lncRNA 0.33 2 2941699 2941947

Neighbor

gene id symbol gene type direction distance location
CI01000304_02900497_02900924 NA coding downstream 39597 2899799 ~ 2902102 (-)
CI01000304_02694838_02711363 NA coding downstream 230197 2694660 ~ 2711502 (-)
CI01000304_02595522_02611332 GRIN3A coding downstream 330367 2595522 ~ 2611332 (-)
CI01000304_02314977_02384157 NA coding downstream 557542 2314977 ~ 2384157 (-)
CI01000304_02299398_02304171 NA coding downstream 636537 2299143 ~ 2305162 (-)
CI01000304_03158811_03160301 NA coding upstream 216546 3158493 ~ 3160301 (-)
CI01000304_03214897_03241215 MUSK coding upstream 271536 3213483 ~ 3241215 (-)
CI01000304_03268621_03269674 NA coding upstream 326674 3268621 ~ 3270242 (-)
CI01000304_03305219_03313206 NA coding upstream 363272 3305219 ~ 3313398 (-)
CI01000304_03398119_03398652 NA coding upstream 456092 3398039 ~ 3400370 (-)
G419756 NA non-coding downstream 47210 2889285 ~ 2894489 (-)
G419640 NA non-coding downstream 137911 2803579 ~ 2803788 (-)
G419524 NA non-coding downstream 303875 2637538 ~ 2637824 (-)
G419499 NA non-coding downstream 351400 2589967 ~ 2590299 (-)
G419498 NA non-coding downstream 352516 2588293 ~ 2589183 (-)
G419783 NA non-coding upstream 21643 2963590 ~ 2963803 (-)
G419840 NA non-coding upstream 137419 3079366 ~ 3079602 (-)
G419842 NA non-coding upstream 143472 3085419 ~ 3086625 (-)
G420221 NA non-coding upstream 445731 3387678 ~ 3389213 (-)
G420150 NA non-coding upstream 477975 3419922 ~ 3478109 (-)
G419354 NA other downstream 675458 2262502 ~ 2266241 (-)
G419353 NA other downstream 705593 2229384 ~ 2236106 (-)
CI01000304_04263955_04264962 NA other upstream 1321798 4263846 ~ 4265201 (-)
CI01000304_04661808_04672936 PPWD1 other upstream 1719869 4661766 ~ 4672947 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other upstream 3535504 6480743 ~ 6483986 (-)
G422354 NA other upstream 3689139 6631086 ~ 6631499 (-)
G422378 NA other upstream 3802732 6744679 ~ 6783046 (-)

Expression


Co-expression Network