G456363


Basic Information

Item Value
gene id G456363
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000320
NCBI id null
chromosome length 3894707
location 3672851 ~ 3673077 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU523880
TAGGTTTAAGCCTTGTCTGTGAAACCAGGGATAGAGGTTTTAGTTTATGAATTAAACTCTAAACAGGATGTGTTCTAAATTTGAGGTTGATGTCTCATAAAAAATAAAAATAAAAACCTTTCAGTAAGATTTTGTTTGGGTGCAATACCAAACGTTTTCCATTAGATGCCAGCAAAGCTTAACTGGTGAGATTTGTGATTTGCAGTACAGTATAATTTCTCTCTCTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU523880 True 227 lncRNA 0.33 1 3672851 3673077

Neighbor

gene id symbol gene type direction distance location
CI01000320_03639518_03642111 NKIRAS1 coding downstream 30740 3639395 ~ 3642111 (-)
CI01000320_03564239_03566141 NA coding downstream 105866 3563774 ~ 3566985 (-)
CI01000320_03536880_03548445 NA coding downstream 124376 3535246 ~ 3548475 (-)
CI01000320_03521826_03531909 FHL3, SF3A3.S, SF3A3 coding downstream 140942 3521600 ~ 3531909 (-)
CI01000320_03456251_03458846 STMN1, STMN1A, STMN1B coding downstream 214005 3456131 ~ 3458846 (-)
CI01000320_03825336_03853470 NA coding upstream 151586 3824663 ~ 3853686 (-)
G456359 NA non-coding downstream 20232 3652343 ~ 3652619 (-)
G456356 NA non-coding downstream 23701 3648727 ~ 3649150 (-)
G456324 NA non-coding downstream 34144 3637521 ~ 3638707 (-)
G456343 NA non-coding downstream 64450 3608123 ~ 3608401 (-)
G456342 NA non-coding downstream 64925 3607708 ~ 3607926 (-)
G456364 NA non-coding upstream 459 3673536 ~ 3673762 (-)
G456371 NA non-coding upstream 11348 3684425 ~ 3684713 (-)
G456384 NA non-coding upstream 41613 3714690 ~ 3714933 (-)
G456398 NA non-coding upstream 67587 3740664 ~ 3747800 (-)
G456406 NA non-coding upstream 77826 3750903 ~ 3751339 (-)
G456317 NA other downstream 24811 3643237 ~ 3648040 (-)
CI01000320_01426753_01430603 NA other downstream 2242198 1426176 ~ 1430654 (-)
CI01000320_01338270_01341123 SH3BGRL3 other downstream 2331635 1336279 ~ 1343274 (-)
G454686 NA other downstream 2530971 1141242 ~ 1141880 (-)
G454663 NA other downstream 2616956 1051468 ~ 1055895 (-)

Expression


Co-expression Network