G481576


Basic Information

Item Value
gene id G481576
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000339
NCBI id null
chromosome length 8057057
location 1317607 ~ 1317886 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU552596
CTAAAAACCATGTCAGTTTGGGTTGAAATTCTTTGAAGTTCAAGTATTAGCATTATAAACACTGAATTAATACGAACATATGAAATTAAATTAAGGACATGCATCAGAAAAATTGTGAATGATGGACAATAAATATATAACAGGAATATAACAGCTTGACAGTAAACTGTTTTTGCAGTATTGTCTTATATTAATGTCCGTTAAAGCAAGACTATGTAAACAAAAAAACACAGCCACTGTGTCCAAAAGTGGCAATTATGGGATAACAGACACAGCAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU552596 True 280 lncRNA 0.31 1 1317607 1317886

Neighbor

gene id symbol gene type direction distance location
CI01000339_01287752_01312897 NA coding downstream 4710 1286922 ~ 1312897 (-)
CI01000339_01242435_01246985 NA coding downstream 70622 1241131 ~ 1246985 (-)
CI01000339_01172551_01191348 SPOCK3 coding downstream 126259 1171336 ~ 1191348 (-)
CI01000339_01082705_01091230 LAS1L coding downstream 226377 1082643 ~ 1091230 (-)
CI01000339_01061363_01065408 ZC4H2.L, ZC4H2, HC127 coding downstream 251511 1060274 ~ 1066096 (-)
CI01000339_01327907_01343305 GLRA3, GLRA4A, GLRA4B, GLRA4 coding upstream 9831 1327717 ~ 1344940 (-)
CI01000339_01346138_01360618 AIFM1 coding upstream 27856 1345742 ~ 1360618 (-)
CI01000339_01373395_01377800 NA coding upstream 55509 1373395 ~ 1377800 (-)
CI01000339_01385481_01386022 NA coding upstream 67145 1384306 ~ 1386094 (-)
CI01000339_01394345_01398989 NA coding upstream 76356 1394242 ~ 1398989 (-)
G481163 NA non-coding downstream 177565 1138563 ~ 1140042 (-)
G481272 NA non-coding downstream 259283 1056645 ~ 1058324 (-)
G481266 NA non-coding downstream 355119 961751 ~ 962488 (-)
G481261 NA non-coding downstream 395881 921375 ~ 921726 (-)
G481253 NA non-coding downstream 426432 890944 ~ 891175 (-)
G481557 NA non-coding upstream 4481 1322367 ~ 1326907 (-)
G481578 NA non-coding upstream 10781 1328667 ~ 1328867 (-)
G481588 NA non-coding upstream 49061 1366947 ~ 1367223 (-)
G481589 NA non-coding upstream 50480 1368366 ~ 1368577 (-)
G481593 NA non-coding upstream 64626 1382512 ~ 1382734 (-)
G481157 NA other downstream 201459 1114129 ~ 1116148 (-)
CI01000339_00932339_00951205 SMARCA1 other downstream 364173 931680 ~ 951205 (-)
G480969 NA other downstream 1227410 85093 ~ 90197 (-)
G481610 NA other upstream 253651 1571537 ~ 1573962 (-)
G481662 NA other upstream 405884 1723770 ~ 1733019 (-)
CI01000339_01988812_02024891 NA other upstream 671289 1988537 ~ 2025183 (-)
G483104 NA other upstream 2076222 3394108 ~ 3401228 (-)
G483199 NA other upstream 2460005 3777891 ~ 3778551 (-)

Expression


Co-expression Network