G678654


Basic Information

Item Value
gene id G678654
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 714434 ~ 714846 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU799313
ACAAATGCACAGTTCCCTATGGTTGGCGCTAAAGGAACCGAAACTGCTTGTTGTCAAGGCCAGGACTGAGGCTGCTCACTTTTGCAAGACTATAATACACCTCCTGATCTACTGAGATTTCTTTGACTGAGGTTGGTGCCTCTCAGTTCCATTCAAAACGACTGCAAAAACTCTCTTTTAACTTTCAGCCATAGAACTTTTGAATGAATGTATTGAATTGACACATTTGTCAGACTATTTTATTGTGCATTCAGGTATTTTTTACTACATGACCTTGGTGTTGCTTTTTTGCACCGTGTTTTACCGGACGAGCGATAATTGCAATAATTGTTGCTTCTTAGTTCAAGATACATTTGATCAGGATGTGTTCCTTGGGAATAAAACCCTTGACCTTGAGTTGAAAGTAGTAGCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU799313 True 413 lncRNA 0.39 1 714434 714846

Neighbor

gene id symbol gene type direction distance location
CI01180000_00661446_00671602 MSH6 coding upstream 42246 661109 ~ 672188 (+)
CI01180000_00427700_00437883 NA coding upstream 275968 427650 ~ 438466 (+)
CI01180000_00368639_00375465 ZC3H6 coding upstream 338187 368639 ~ 376247 (+)
CI01180000_00361420_00364335 NA coding upstream 349308 361420 ~ 365126 (+)
CI01180000_00306160_00314770 NA coding upstream 398690 306160 ~ 315744 (+)
CI01180000_00737754_00743866 NA coding downstream 20464 735310 ~ 744211 (+)
CI01180000_00765917_00776252 NA coding downstream 50951 765797 ~ 776911 (+)
CI01180000_00812535_00858607 NA coding downstream 97011 811857 ~ 859005 (+)
CI01180000_00862066_00867985 NA coding downstream 145900 860746 ~ 868112 (+)
CI01180000_00947514_00949868 NA coding downstream 231575 946421 ~ 950906 (+)
G678703 NA non-coding upstream 15380 698675 ~ 699054 (+)
G678632 NA non-coding upstream 29391 677874 ~ 685043 (+)
G678595 NA non-coding upstream 163260 503871 ~ 551174 (+)
G678608 NA non-coding upstream 180786 533150 ~ 533648 (+)
G678442 NA non-coding upstream 221803 445739 ~ 492631 (+)
G678712 NA non-coding downstream 7277 722123 ~ 722457 (+)
G678640 NA non-coding downstream 32419 747265 ~ 777004 (+)
G678633 NA non-coding downstream 62761 777607 ~ 779619 (+)
G678629 NA non-coding downstream 64948 779794 ~ 780590 (+)
G678717 NA non-coding downstream 69069 783915 ~ 784202 (+)
G678440 NA other upstream 562782 147934 ~ 151652 (+)
G678751 NA other downstream 344997 1059843 ~ 1066091 (+)
G678637 NA other downstream 434705 1149551 ~ 1155672 (+)
G678946 NA other downstream 803507 1518353 ~ 1612547 (+)
G679076 NA other downstream 1080324 1795170 ~ 1799433 (+)
G679324 NA other downstream 1674021 2388867 ~ 2397360 (+)

Expression


Co-expression Network