G681674



Basic Information


Item Value
gene id G681674
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 6645108 ~ 6645323 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU802648
ACTGCTTCATGAAGCTTCGAAGCTTTACGAATGTTTTGTTTTGAATCAGTGGTTCGGAGCATGTATCAAACTGCCAAAGTCACGTGAACTATTGAAGTTTCAAAACACTTAGGACGTAACGAATCCTCCTTTGTTGAAATCATGTGATTTTGGCGCTCTGAACCACTGATTCGAAACGAATGATTCGTAAGCTTCGAAGCTTCATGAAGCAGTGTT

Function


NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU802648 True 216 lncRNA 0.40 1 6645108 6645323

Neighbor


gene id symbol gene type direction distance location
CI01180000_06638215_06643427 TTL coding upstream 1288 6637809 ~ 6643820 (+)
CI01180000_06608734_06626459 IKAROS, IKZF1 coding upstream 18296 6608734 ~ 6626812 (+)
CI01180000_06581704_06589445 NA coding upstream 55627 6580990 ~ 6589481 (+)
CI01180000_06532667_06556697 VWC2 coding upstream 87604 6532276 ~ 6557504 (+)
CI01180000_06503211_06517041 NA coding upstream 128006 6503211 ~ 6517102 (+)
CI01180000_06704767_06711402 BAG5 coding downstream 59444 6704767 ~ 6712156 (+)
CI01180000_06714748_06715005 NA coding downstream 69282 6714605 ~ 6715107 (+)
CI01180000_06755090_06760583 NA coding downstream 109767 6755090 ~ 6760583 (+)
CI01180000_06762114_06762590 NA coding downstream 116791 6762114 ~ 6762772 (+)
CI01180000_06813558_06824034 NA coding downstream 167339 6812662 ~ 6824522 (+)
G681685 NA non-coding upstream 13179 6631653 ~ 6631929 (+)
G681683 NA non-coding upstream 14562 6630330 ~ 6630546 (+)
G681682 NA non-coding upstream 15045 6629825 ~ 6630063 (+)
G681592 NA non-coding upstream 166109 6471995 ~ 6478999 (+)
G681591 NA non-coding upstream 177884 6442303 ~ 6467224 (+)
G681652 NA non-coding downstream 119 6645442 ~ 6646838 (+)
G681706 NA non-coding downstream 90530 6735853 ~ 6736093 (+)
G681708 NA non-coding downstream 92276 6737599 ~ 6737901 (+)
G681739 NA non-coding downstream 191996 6837319 ~ 6837698 (+)
G681749 NA non-coding downstream 233238 6878561 ~ 6878839 (+)
G681686 NA other upstream 10119 6632908 ~ 6634989 (+)
G681268 NA other upstream 1271346 5370410 ~ 5373762 (+)
G681137 NA other upstream 1859477 4783305 ~ 4785631 (+)
G680736 NA other upstream 2860667 3765691 ~ 3784441 (+)
G681667 NA other downstream 10523 6655846 ~ 6659546 (+)
CI01180000_07403482_07412752 HELLS other downstream 757824 7403482 ~ 7413190 (+)
CI01180000_07694615_07695428 MRPL14 other downstream 1018100 7694529 ~ 7695667 (+)
G682232 NA other downstream 1722862 8368185 ~ 8368935 (+)
CI01180000_09036547_09038313 MGST3B other downstream 2391094 9035736 ~ 9038892 (+)

Expression



Co-expression Network