G681990


Basic Information

Item Value
gene id G681990
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 7645821 ~ 7646152 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU803016
GTGACCTCATACCTAAAAACATTCCAAGTGCAAAAGTCACATGTTTTCAAAGCTATCACGGCACTGCTAGCCCGCATGTGTTTATACCTGTTATGCTCCTCGCAGATCTTAAAAACCCTTTAAAATGAAATGTCTTGACAAGCACAGTTTTCTTTTTGTGCTGATATATGAAAAATGATGTATCAAAGGCATCACCCTTTTATTATTAACCCTTGTGTGTCCTTATGGACATTTTTGTCCTTTTCAGTTTGTTTGTTTTGTTTTTTTTCATTTTGCCTGTGCTAAAGGAACACTCCACTTTTTTTGAAAATAGGCTCATTTTCCAACTCCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU803016 True 332 lncRNA 0.36 1 7645821 7646152

Neighbor

gene id symbol gene type direction distance location
CI01180000_07630010_07630436 NA coding upstream 14905 7629585 ~ 7631154 (+)
CI01180000_07558791_07591349 CPEB3 coding upstream 53929 7558791 ~ 7591892 (+)
CI01180000_07508387_07529689 IDE coding upstream 115524 7508069 ~ 7530297 (+)
CI01180000_07472651_07489000 OPN3 coding upstream 156472 7470005 ~ 7489349 (+)
CI01180000_07431871_07436446 NA coding upstream 209196 7430824 ~ 7436625 (+)
CI01180000_07655737_07662839 MLH1 coding downstream 8671 7654823 ~ 7662932 (+)
CI01180000_07694615_07695428 MRPL14 coding downstream 48377 7694529 ~ 7695667 (+)
CI01180000_07802968_07887251 CDH23 coding downstream 156816 7802968 ~ 7887251 (+)
CI01180000_07939719_07956224 CDH23 coding downstream 293040 7939192 ~ 7957335 (+)
CI01180000_08012978_08021101 SMOC2 coding downstream 366826 8012978 ~ 8021401 (+)
G681986 NA non-coding upstream 18847 7626066 ~ 7626974 (+)
G681854 NA non-coding upstream 149410 7492495 ~ 7496411 (+)
G681831 NA non-coding upstream 154424 7413309 ~ 7491397 (+)
G681963 NA non-coding upstream 163987 7476992 ~ 7481834 (+)
G681991 NA non-coding downstream 663 7646815 ~ 7647036 (+)
G681992 NA non-coding downstream 1005 7647157 ~ 7647374 (+)
G681993 NA non-coding downstream 1538 7647690 ~ 7647940 (+)
G681823 NA non-coding downstream 41175 7687327 ~ 7713392 (+)
G681819 NA non-coding downstream 80308 7726460 ~ 7728061 (+)
CI01180000_07403482_07412752 HELLS other upstream 176216 7403482 ~ 7413190 (+)
G681667 NA other upstream 986275 6655846 ~ 6659546 (+)
G681686 NA other upstream 1010832 6632908 ~ 6634989 (+)
G681592 NA other upstream 1166822 6471995 ~ 6478999 (+)
G681268 NA other upstream 2272059 5370410 ~ 5373762 (+)
G682232 NA other downstream 722033 8368185 ~ 8368935 (+)
CI01180000_09036547_09038313 MGST3B other downstream 1390265 9035736 ~ 9038892 (+)
G685188 NA other downstream 3173834 10819986 ~ 10866176 (+)
G685443 NA other downstream 3487580 11133732 ~ 11141722 (+)

Expression


Co-expression Network