G684738


Basic Information

Item Value
gene id G684738
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 9632645 ~ 9632999 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU806109
CCAAATTTTCTGAGGAGAAACGATCGCTTTATATGATGAACAGATTGAATTTAGGCTTTTATTCACATATAAACATTCATTAACACACACATTGGTTAGCTCAAGCAAGTTTGCTTGACGCGTGCGAGAACCAATGAGGTTCATTCTCGTGTGTTACGCATCACGTTTGAGCCTCCAGAAGAGGTTTGTTCTTGCGGGTCAAGCAGATTCGGTTGAGCTTCTGTTTATGTTCGCCGATCAATGTTTATATGTGAATAAAAGCCTAAATTAAATCTGTTCATCATATAAAGCAATCAAGTCTCTTCAGAAAATTTGGACTAAATTTGGATTATTTTTACGATCTCTTTATGAACTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU806109 True 355 lncRNA 0.36 1 9632645 9632999

Neighbor

gene id symbol gene type direction distance location
CI01180000_09568657_09570949 NA coding downstream 61517 9567425 ~ 9571128 (-)
CI01180000_09515348_09519388 PREPL coding downstream 113257 9514397 ~ 9519388 (-)
CI01180000_09389794_09446057 NA coding downstream 186588 9389794 ~ 9446057 (-)
CI01180000_09367707_09378410 ABCG5 coding downstream 254182 9367595 ~ 9378463 (-)
CI01180000_09361267_09366764 NA coding downstream 265881 9360894 ~ 9366764 (-)
CI01180000_09712937_09715071 SIX2A, SIX2 coding upstream 79732 9712381 ~ 9715548 (-)
CI01180000_09797406_09801305 NA coding upstream 164094 9797093 ~ 9801321 (-)
CI01180000_09862542_09863408 NA coding upstream 229137 9862136 ~ 9863760 (-)
CI01180000_09880982_09883947 PRDX3 coding upstream 247811 9880810 ~ 9884190 (-)
CI01180000_09889952_09893572 FAM45A coding upstream 256443 9889442 ~ 9893572 (-)
G684717 NA non-coding downstream 29363 9603032 ~ 9603282 (-)
G684643 NA non-coding downstream 182961 9449087 ~ 9449684 (-)
G684414 NA non-coding downstream 372990 9247020 ~ 9259655 (-)
G684419 NA non-coding downstream 379909 9235405 ~ 9252736 (-)
G684562 NA non-coding downstream 560404 9072001 ~ 9072241 (-)
G684737 NA non-coding upstream 131 9633130 ~ 9633415 (-)
G684735 NA non-coding upstream 524 9633523 ~ 9634496 (-)
G684739 NA non-coding upstream 1550 9634549 ~ 9634930 (-)
G684741 NA non-coding upstream 2913 9635912 ~ 9636116 (-)
G684746 NA non-coding upstream 7659 9640658 ~ 9640879 (-)
G684493 NA other downstream 908778 8722693 ~ 8723867 (-)
G684182 NA other downstream 1721437 7910761 ~ 7911208 (-)
G684080 NA other downstream 2049842 7579404 ~ 7582803 (-)
G684071 NA other downstream 2106991 7506890 ~ 7525654 (-)
G684018 NA other downstream 2219513 7403147 ~ 7413132 (-)
G684929 NA other upstream 265425 9895316 ~ 9901388 (-)
G686052 NA other upstream 1708617 11341616 ~ 11343496 (-)

Expression


Co-expression Network