Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G686149

Basic Information

Item	Value
gene id	G686149
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01180000
NCBI id	null
chromosome length	11503085
location	11418738 ~ 11418952 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU807642
TATGACGCAGGATGTAGGAGTATTGTAAGCTTAGACGCATCTCACGGTTCAAACAAATAGGGCTGTGCAACAAACTCAAGCTCCTCTTCTCTTAGAGGATTTCGATATGACATTTCTCTTTACATTTCTTGTTTTAGACTTCTAATTCATGACCGGTGTTTTGTTTTGCTCTCTCCTCTGCGCTTCCACGTTCGTCATAGCGTTCGGGTCAAAGG

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU807642	True	215	lncRNA	0.43	1	11418738	11418952

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01180000_11127163_11138849	NA	coding	downstream	279889	11126317 ~ 11138849 (-)
CI01180000_11111159_11112550	NA	coding	downstream	306188	11110801 ~ 11112550 (-)
CI01180000_11106711_11107109	SPRN	coding	downstream	310844	11106466 ~ 11107894 (-)
CI01180000_11098239_11100667	ELOVL6L	coding	downstream	318071	11097736 ~ 11100667 (-)
CI01180000_11091600_11093609	NA	coding	downstream	325048	11091322 ~ 11093690 (-)
G686048	NA	non-coding	downstream	722	11415389 ~ 11418016 (-)
G686124	NA	non-coding	downstream	71135	11347200 ~ 11347603 (-)
G686123	NA	non-coding	downstream	72123	11346389 ~ 11346615 (-)
G686121	NA	non-coding	downstream	73573	11344844 ~ 11345165 (-)
G686120	NA	non-coding	downstream	74025	11344249 ~ 11344713 (-)
G686150	NA	non-coding	upstream	929	11419881 ~ 11420230 (-)
G686153	NA	non-coding	upstream	13917	11432869 ~ 11441416 (-)
G686176	NA	non-coding	upstream	55474	11474426 ~ 11476027 (-)
G686181	NA	non-coding	upstream	66229	11485181 ~ 11490006 (-)
G686052	NA	other	downstream	75242	11341616 ~ 11343496 (-)
G684929	NA	other	downstream	1517350	9895316 ~ 9901388 (-)
G684493	NA	other	downstream	2694871	8722693 ~ 8723867 (-)
G684182	NA	other	downstream	3507530	7910761 ~ 7911208 (-)
G684080	NA	other	downstream	3835935	7579404 ~ 7582803 (-)

Expression

Co-expression Network